Check patentability & draft patents in minutes with Patsnap Eureka AI!

Heavy metal cadmium resistance related protein DbsCzcA as well as coding gene and application thereof

A resistance-related, gene-encoding technology, applied in recombinant DNA technology, DNA/RNA fragments, chemical instruments and methods, etc., can solve problems such as huge and unexplored gene resource pools, and achieve the effect of great application value

Active Publication Date: 2012-07-25
SUN YAT SEN UNIV
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, cultured microorganisms account for less than 1% of microorganisms in nature, so microbial metagenomes in various habitats represent a huge and undiscovered genetic resource pool

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Heavy metal cadmium resistance related protein DbsCzcA as well as coding gene and application thereof
  • Heavy metal cadmium resistance related protein DbsCzcA as well as coding gene and application thereof
  • Heavy metal cadmium resistance related protein DbsCzcA as well as coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1D

[0025] Cloning of the full sequence of the DbsCzcA gene of embodiment 1

[0026] Field microbial sample collection:

[0027] AMD in different acidification stages (based on pH) was selected in the Yunfu lead / zinc mine, and cells in 20LAMD were collected using a 0.22 μm filter membrane. In order to maintain the complete preservation of the nucleic acid, the samples were frozen in liquid nitrogen, brought back to the laboratory within 24 hours, and stored in a -70°C refrigerator for long-term storage.

[0028] Nucleic acid extraction:

[0029] DNA extraction adopts the SET method, and the process is as follows: add lysozyme and proteinase K to the SET buffer, digest for 30 minutes, centrifuge at 15,000 rpm for 15 minutes, extract twice with chloroform, precipitate with isopropanol overnight, and wash twice with 75% ethanol , and finally dissolved in sterile water. The genomic DNA was purified and recovered by Qiagen tip-100 column, and the DNA quality and concentration were d...

Embodiment 2D

[0040] Functional analysis of embodiment 2DbsCzcA gene

[0041] In this example, the function of the DbsCzcA gene was analyzed using Escherichia coli transformation experiments.

[0042] Construction of recombinant expression vectors:

[0043] The following pair of primers were designed to introduce a BamHI restriction site at the 5' of the DbsCzcA gene and an XhoI restriction site at the 3'.

[0044] DbsCzcA-F (SEQ ID NO: 3):

[0045] 5'CGCGGATCCATGCTCAAAGCCATTTTAGCCT3'

[0046] DbsCzcA-R (SEQ ID NO: 4):

[0047] 5'CCGCTCGAGCTGATCTTCCTCATCCATCTGG3'

[0048] PCR2.1-DbsCzcA vector was used as template for PCR. The PCR product and the yeast shuttle expression vector pET28a were digested with BamHI and XhoI, respectively, and the digested products were recovered, ligated, and transformed into Escherichia coli DH5α. After sequencing and enzyme digestion identification, the pET28a-DbsCzcA recombinant was obtained.

[0049] Protein:

[0050] The recombinant pET28a-DbsCzcA wa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses metal cadmium resistance related protein DbsCzcA as well as a coding gene and application of the protein. An amino acid sequence of the cadmium resistance related protein DbsCzcA is shown in SEQID NO:1, and the coding gene is shown in SEQIDNO:2. According to the experiment of transformation of Escherichia coli, as a result of the expression of the gene in Escherichia coli, the resistance to heavy metal cadmium can be improved. The DbsCzcA coding gene disclosed by the invention can be used for improving resistance to the heavy metal cadmium of microorganism and plants, and further can be used for clearing environment pollution of the heavy metals, and can provide biological resources with excellent performances for bioremediation.

Description

technical field [0001] The invention belongs to the field of microbial genetic engineering and bioremediation. Specifically, the present invention provides a sequence of a gene resistant to heavy metal cadmium, namely the cation efflux system protein gene (DbsCzcA), contained in an unknown microorganism living in acid mining drainage (AMD), And the sequence deduces the amino acid sequence of the encoded protein molecule. The invention has great application value in improving the resistance of microorganisms and plants to heavy metal cadmium. Background technique [0002] With the development and utilization of mineral resources and industrial development, the pollution caused by heavy metals to the environment is becoming more and more serious. Soil heavy metal pollution has become a problem that endangers the quality of the global environment. Heavy metals in soil can affect the growth and development of plants, reduce the yield and quality of crops, and cause serious eco...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/00C12N15/11C12N15/63C12N1/21C02F3/00B09C1/00C12R1/19C02F101/22
Inventor 陈亮谢丽娟许光远俞陆军胡敏廖斌束文圣
Owner SUN YAT SEN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com