Check patentability & draft patents in minutes with Patsnap Eureka AI!

Protein OsGPA3 relevant to sorting of plant glutelin, encoding gene of protein OsGPA3 and applications of protein OsGPA3 and encoding gene

A gluten, gene technology, applied in the field of genetic engineering

Inactive Publication Date: 2012-08-01
NANJING AGRICULTURAL UNIVERSITY
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Kelch proteins play an important role in organisms, and there is no report on the research on kelch proteins involved in storage protein sorting

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein OsGPA3 relevant to sorting of plant glutelin, encoding gene of protein OsGPA3 and applications of protein OsGPA3 and encoding gene
  • Protein OsGPA3 relevant to sorting of plant glutelin, encoding gene of protein OsGPA3 and applications of protein OsGPA3 and encoding gene
  • Protein OsGPA3 relevant to sorting of plant glutelin, encoding gene of protein OsGPA3 and applications of protein OsGPA3 and encoding gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1, Discovery of Plant Glutenin Sorting-Related Proteins and Their Encoding Genes

[0048] 1. Phenotype analysis and genetic analysis of rice glutenin sorting mutant Q25

[0049] In Baifeng B's 60 The line Q25 with grain farinity was screened out from the Co radiation mutant library.

[0050] Compared with Baifeng B, the main feature of Q25 is that the grain is powdery and opaque (see figure 2 ). SEM analysis confirmed that the starch granules in Q25 were loose (see figure 2 ), may be the main cause of endosperm opacity. In addition, in the SDS-PAGE pattern of Q25, the 57kDa glutenin precursor increased sharply, and the corresponding mature acidic subunit and basic subunit content decreased. At the same time, the globulin content decreased, and gliadin did not show significant difference (see image 3 ).

[0051] There are two types of protein bodies in rice endosperm, protein body I and protein body II. The former is composed of prolamins, and the latt...

Embodiment 2

[0098] Embodiment 2, the acquisition and identification of transgenic plants

[0099] 1. Construction of recombinant expression vector

[0100] Using the genomic DNA of Baifeng B (purchased from the germplasm resource bank of the Institute of Crop Science, Chinese Academy of Agricultural Sciences) as a template, the OsGPA3 gene was obtained by PCR amplification. The PCR primer sequences are as follows:

[0101] primer3 (the underlined sequence is the SmaI restriction site):

[0102] 5'AATTCGAGCTCGGTA CCCGGG GTGGGAAGAACTAGGAAGGTTGTCG 3' (SEQ ID NO. 6)

[0103] primer4 (the underlined sequence is the SmaI restriction site):

[0104] 5'CGACTCTAGAGGATC CCCGGG TGGAAGGAAATAGGGTCACAAGGG 3' (SEQ ID NO. 7)

[0105] The above primers are located at 2.7kb upstream and 3.1kb downstream of the gene shown in Sequence 2, the amplified product contains the promoter part of the gene, and the PCR product is recovered and purified. The PCR product was cloned into the vector pCAMBIA1305.1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of gene engineering, and relates to a protein OsGPA3 relevant to sorting of plant glutelin, an encoding gene of the protein OsGPA3 and applications of the protein OsGPA3. The protein is a protein (a) consisting of an amino acid sequence shown in a sequence table 1 or a protein (b) which is prepared by replacing and / or removing and / or adding one or several amino acid residues in the amino acid sequence in the sequence table 1 and is relevant to the sorting of the plant glutelin and derivates from the sequence 1. The protein influences the sorting of glutelin precursors in a plant endosperm. The encoding gene of the protein is introduced into a plant in which the glutelin is sorted abnormally, so that a transgenic plant in which the glutelin is sorted normally can be cultured. The protein and the encoding gene thereof can be applied to genetic improvement of plants.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and relates to a plant gluten protein sorting-related protein OsGPA3, its coding gene and application. Background technique [0002] Rice is one of the most important food crops in the world. The successful application of hybrid rice has largely solved the food problem caused by the rapid increase in the world's population. However, with the continuous improvement of people's living standards, the cultivation of high-quality, high-nutrition and various functional rice is becoming an urgent problem. As the second largest nutrient in rice, rice seed storage protein determines the nutritional value of rice to a large extent. Therefore, the in-depth study of its synthetic transport pathway will help us improve rice through genetic engineering. [0003] Rice glutenin is first synthesized in the endoplasmic reticulum in the form of a 57kDa precursor, correctly folded with the assistance of molecula...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29C12N15/63C12N5/10C12N1/21C12N15/11C12N15/82A01H5/00
Inventor 万建民任玉龙王益华鲍依群刘峰江玲
Owner NANJING AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More