Plant male fertility related protein and coded gene and application thereof
A male fertility and plant technology, applied in the field of genetic engineering, can solve the problems of unclear mechanism of rice anther dehiscence, mature anthers cannot dehisce well, and development is not perfect, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Embodiment 1, the discovery of plant male fertility-related protein and its coding gene
[0047] 1. Fertility analysis and genetic analysis of rice sterile mutant Rad1
[0048] A rice plant Rad1 with non-dehiscated glumes and anthers was found in the radiation-induced field of the japonica rice variety Nipponbare (rice whole genome sequencing material). Two types of segregation, fertile and sterile, appeared in the offspring, which were controlled by a single recessive gene through genetic analysis. In addition, treatment of Nipponbare with the exogenous hormone auxin can obtain the mutant phenotype.
[0049] Compared with Nipponbare, the main features of the mutant are: vegetative growth and floral organ development are basically normal, with 6 stamens and 1 pistil. But after heading, the florets of the mutant cannot open, the filaments of the mutant cannot be stretched out, and the stigma cannot be exposed (see figure 1 ), under the stereoscope, it was observed tha...
Embodiment 2
[0093] Embodiment 2, the acquisition and identification of transgenic plants
[0094] 1. Construction of recombinant expression vector
[0095] Using the genomic DNA of Nipponbare (purchased from the germplasm resource bank of the Institute of Crop Science, Chinese Academy of Agricultural Sciences) as a template, the OsRad1 gene was obtained by PCR amplification. The PCR primer sequences are as follows:
[0096] primer1 (the underlined sequence is the EcoRI recombination site):
[0097] 5'- CCATGATTACGAATTC CCTTTTCATAATCAGACAGAGA-3' (SEQ ID NO.4)
[0098] primer2 (the underlined sequence is the EcoRI recombination site):
[0099] 5'- TACCGAGCTCGAATTCCGTAGAGTAGCATAGTGGCATC -3' (SEQ ID NO.5)
[0100] The above primers are located at 3.2 kb upstream and 1.6 kb downstream of the gene shown in SEQ ID NO.2, the amplified product contains the promoter part of the gene, and the PCR product is recovered and purified. Using In- The HD Cloning Kit recombination kit (Takara comp...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap