Plant male fertility related protein and coded gene and application thereof

A male fertility and plant technology, applied in the field of genetic engineering, can solve the problems of unclear mechanism of rice anther dehiscence, mature anthers cannot dehisce well, and development is not perfect, etc.

Inactive Publication Date: 2012-08-01
NANJING AGRICULTURAL UNIVERSITY
View PDF2 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Second, it was found that the "interstitial gap" of the anthers was not well developed, so that the mature anthers of the hybrid could not dehisce well
At present, the mechanism of rice anther dehiscence is not clear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant male fertility related protein and coded gene and application thereof
  • Plant male fertility related protein and coded gene and application thereof
  • Plant male fertility related protein and coded gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Embodiment 1, the discovery of plant male fertility-related protein and its coding gene

[0047] 1. Fertility analysis and genetic analysis of rice sterile mutant Rad1

[0048] A rice plant Rad1 with non-dehiscated glumes and anthers was found in the radiation-induced field of the japonica rice variety Nipponbare (rice whole genome sequencing material). Two types of segregation, fertile and sterile, appeared in the offspring, which were controlled by a single recessive gene through genetic analysis. In addition, treatment of Nipponbare with the exogenous hormone auxin can obtain the mutant phenotype.

[0049] Compared with Nipponbare, the main features of the mutant are: vegetative growth and floral organ development are basically normal, with 6 stamens and 1 pistil. But after heading, the florets of the mutant cannot open, the filaments of the mutant cannot be stretched out, and the stigma cannot be exposed (see figure 1 ), under the stereoscope, it was observed tha...

Embodiment 2

[0093] Embodiment 2, the acquisition and identification of transgenic plants

[0094] 1. Construction of recombinant expression vector

[0095] Using the genomic DNA of Nipponbare (purchased from the germplasm resource bank of the Institute of Crop Science, Chinese Academy of Agricultural Sciences) as a template, the OsRad1 gene was obtained by PCR amplification. The PCR primer sequences are as follows:

[0096] primer1 (the underlined sequence is the EcoRI recombination site):

[0097] 5'- CCATGATTACGAATTC CCTTTTCATAATCAGACAGAGA-3' (SEQ ID NO.4)

[0098] primer2 (the underlined sequence is the EcoRI recombination site):

[0099] 5'- TACCGAGCTCGAATTCCGTAGAGTAGCATAGTGGCATC -3' (SEQ ID NO.5)

[0100] The above primers are located at 3.2 kb upstream and 1.6 kb downstream of the gene shown in SEQ ID NO.2, the amplified product contains the promoter part of the gene, and the PCR product is recovered and purified. Using In- The HD Cloning Kit recombination kit (Takara comp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a plant male fertility related protein and a coded gene and application thereof. The protein is of (a) or (b): (a) the protein formed by an amino acid sequence indicated in SEQ ID NO.1; and (b) the protein related to plant male fertility and derivate from the SEQ ID NO.1 by using one or a plurality of amino acid residues to replace and / or delete and / or add in the amino acid sequence 1. The plant male fertility related protein influences the anther cracking process of plants. Plant male fertility can be reduced and maturing rate can be affected by restraining expression of the coded gene of the protein, and accordingly transgenic plants with male anther non-cracking variation and plant male sterile line transgenic plants can be cultured. Male fertile transgenic plants can be cultured by introducing the coded gene of the protein into male sterile plants. The protein and the coded gene of the protein can be applied to plant genetic improvement.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and relates to a plant male fertility-related protein, its coding gene and its application. Background technique [0002] The anther dehiscence characteristic of rice affects the pollen fertility of the plant by controlling the amount of pollen germinated on the stigma, and is an important factor affecting the seed setting rate of rice. Indica-japonica hybrid F1 plants generally have serious anther non-dehiscence disorders, mainly showing that one or two anther cells of some anthers do not dehisce during flowering, and the anther epidermal cells are irregular in shape and insufficiently enlarged. From an anatomical analysis, there are several reasons why the anthers cannot dehisce normally. One is that the "interstitial space" of the anthers in the inter-subspecies combination is not fully developed, and the vascular bundle cells of the connective septum are tightly bound together. Difficulty ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/02C12N15/53C12N15/63C12N5/10C12N1/21C12N15/11C12N15/82C12N15/84A01H5/00
Inventor万建民赵志刚江玲张云辉余晓文刘喜刘世家陈亮明
OwnerNANJING AGRICULTURAL UNIVERSITY