4*Tbeta4 gene and method for expressing 4*Tbeta 4 protein in tobaccos
A gene and tobacco technology, applied in its expression vector and in the field of expressing fusion protein and fusion gene in plants, to achieve the effect of easy scale and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Synthesis and vector construction of embodiment 1 Tβ4 gene
[0044] (1) Gene synthesis
[0045] The 168bp Tβ4 gene of the present invention designed and synthesized according to plant preference codons (including the linker consisting of protective bases and enzyme cleavage sites) has a sequence as shown in SEQ ID NO.1; after synthesis, it is connected to the pUC57 vector, i.e. pUC57 -Tβ4.
[0046] (2) 4×Tβ4 construction
[0047] According to the homologous enzyme characteristics of Xba I and Spe I, the small fragments digested by Xba I and Sac I were combined into the large fragments digested by SpeI and SacI through two enzyme digestions and ligation to realize 4×Tβ4 (592bp ) fusion, and named pUC57-4×Tβ4.
[0048] (3) Plant expression vector construction
[0049] Use KOD plus enzyme to pUC57-4×Tβ4 plasmid as a template, and use primers: Tbeta4F1 (5'ggggatccatgcaccaccaccaccaccacggtaccatgtctagaatgtctga3') and Tbeta4R1 (5'ccgagctcttaactagtcataga 3') to perform PCR a...
Embodiment 26
[0056] Expression of embodiment 26×His-4×Tβ4 in tobacco cells
[0057] 1. Construction of expression vector containing target gene (4×Tβ4)
[0058] Plasmid pMD18-4×Tβ4 was double digested with BamHI and SacI, and the 613bp fragment was recovered to obtain the target gene 4×Tβ4 with His-tag and corresponding cohesive ends, and then cloned into the plant expression vector pCAMBIA2300 (not limited to this, also Including plant expression vectors such as pBI121 or modified pCA2300-twin), through sequencing or enzyme digestion identification, under the premise of ensuring the correct reading frame of the target gene in the expression vector, the expression vector plasmid is transferred into Agrobacterium EHA105, and transform tobacco through Agrobacterium-mediated method.
[0059] 2. Tobacco Genetic Transformation
[0060] Sow the sterilized tobacco seeds on the seedling medium, and take the aseptic leaves of tobacco grown for two weeks as explants for transformation;
[0061] S...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 