Unlock instant, AI-driven research and patent intelligence for your innovation.

4*Tbeta4 gene and method for expressing 4*Tbeta 4 protein in tobaccos

A gene and tobacco technology, applied in its expression vector and in the field of expressing fusion protein and fusion gene in plants, to achieve the effect of easy scale and low cost

Inactive Publication Date: 2013-08-28
SHANGHAI JIAOTONG UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the prior art, there is no report on the expression of 4×Tβ4 in a plant system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 4*Tbeta4 gene and method for expressing 4*Tbeta 4 protein in tobaccos
  • 4*Tbeta4 gene and method for expressing 4*Tbeta 4 protein in tobaccos
  • 4*Tbeta4 gene and method for expressing 4*Tbeta 4 protein in tobaccos

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Synthesis and vector construction of embodiment 1 Tβ4 gene

[0044] (1) Gene synthesis

[0045] The 168bp Tβ4 gene of the present invention designed and synthesized according to plant preference codons (including the linker consisting of protective bases and enzyme cleavage sites) has a sequence as shown in SEQ ID NO.1; after synthesis, it is connected to the pUC57 vector, i.e. pUC57 -Tβ4.

[0046] (2) 4×Tβ4 construction

[0047] According to the homologous enzyme characteristics of Xba I and Spe I, the small fragments digested by Xba I and Sac I were combined into the large fragments digested by SpeI and SacI through two enzyme digestions and ligation to realize 4×Tβ4 (592bp ) fusion, and named pUC57-4×Tβ4.

[0048] (3) Plant expression vector construction

[0049] Use KOD plus enzyme to pUC57-4×Tβ4 plasmid as a template, and use primers: Tbeta4F1 (5'ggggatccatgcaccaccaccaccaccacggtaccatgtctagaatgtctga3') and Tbeta4R1 (5'ccgagctcttaactagtcataga 3') to perform PCR a...

Embodiment 26

[0056] Expression of embodiment 26×His-4×Tβ4 in tobacco cells

[0057] 1. Construction of expression vector containing target gene (4×Tβ4)

[0058] Plasmid pMD18-4×Tβ4 was double digested with BamHI and SacI, and the 613bp fragment was recovered to obtain the target gene 4×Tβ4 with His-tag and corresponding cohesive ends, and then cloned into the plant expression vector pCAMBIA2300 (not limited to this, also Including plant expression vectors such as pBI121 or modified pCA2300-twin), through sequencing or enzyme digestion identification, under the premise of ensuring the correct reading frame of the target gene in the expression vector, the expression vector plasmid is transferred into Agrobacterium EHA105, and transform tobacco through Agrobacterium-mediated method.

[0059] 2. Tobacco Genetic Transformation

[0060] Sow the sterilized tobacco seeds on the seedling medium, and take the aseptic leaves of tobacco grown for two weeks as explants for transformation;

[0061] S...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a 4*Tbeta4 gene and a method for expressing 4*Tbeta 4 protein in tobaccos. The base sequence of the gene is shown as the sequence identification number (SEQ ID NO).2. The method comprises the following steps that: cloning vector plasmids containing fusion gene 4*Tbeta4 are subjected to enzyme digestion, target deoxyribose nucleic acid (DNA) segments are recovered, the target gene 4*Tbeta4 with the corresponding cohesive end is obtained, then, the target gene is cloned into tobacco expression vectors, through sequencing or enzyme digestion identification, the cloning vector plasmids are then guided into agrobacterium tumefaciens by a freeze-thawing method on the premise that the correctness of a reading framework of the target gene in the expression vectors is ensured, and engineering bacteria are obtained; sterilized tobacco seeds are sowed on a sprouting culture medium, and sterile leaves growing for two weeks are taken and are used as explants for conversion; and the 4*Tbeta 4 function protein is extracted. The fusion 4*Tbeta 4 protein provided by the invention has important biological activities and functions in aspects of skin and cornea wound healing and restoration.

Description

technical field [0001] The invention relates to a fusion gene, its expression carrier and a method for expressing the fusion protein in plants, in particular to a 4×Tβ4 gene, its expression carrier and a method for expressing the 4×Tβ4 fusion protein in tobacco. Background technique [0002] Studies have shown that thymosin β4 (thymosin β4, Tβ4) is an important G-actin sequestering factor (G-actin sequestering factor) in eukaryotic cells, and has many important physiological and cellular functions (Goldstein et al. Advances in Molecular Medicine , 2005, 11:421-429), including: promotion of cell migration, angiogenesis, cell survival, stem cell differentiation, regulation of cytokines, chemokines, specific proteases, upregulation of gene expression of cytoplasmic molecules and downregulation of gene expression of nuclear transcription factors ( Huff et al. 2001, International Journal of Biochemistry and Cell Biology, 33: 205-220). It plays an important role in the clinical a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/16C07K14/575C12N15/63C12N15/84A01H5/00
Inventor 赵凌侠王晓磊李善爽杨桂华高美凤
Owner SHANGHAI JIAOTONG UNIV