Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection method of BK virus as well as kit and application thereof

A detection kit and the technology of the kit are applied in the field of BK virus detection methods and kits, and can solve the problem of no BK virus detection kit and the like

Inactive Publication Date: 2013-05-01
THE 309TH HOSPITAL OF CHINESE PEOPLES LIBERATION ARMY +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Domestic research on BK virus has just started, and there is no mature BK virus detection kit

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method of BK virus as well as kit and application thereof
  • Detection method of BK virus as well as kit and application thereof
  • Detection method of BK virus as well as kit and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] 1. Design of primers and probes: Design specific primers BKV-F and BKV-R for the BK virus genome, and Taqman fluorescent probe BKV-P. The fluorescent group labeled at the 5' end of Taqman fluorescent probe BKV-P is 6-carboxyfluorescein (6-carboxyfluorescein, FAM), and the quencher group labeled at the 3' end is Black Hole Quencher 1 (Black Hole Quencher 1 , BHQ1).

[0070] BKV-F: AGAACTGCTCCTCAATGGATG

[0071] BKV-R: AGCTGCCCCTGGACACTCT

[0072] BKV-P: TGCTCTTGAAGCATATGAAGATGGCCCCA

[0073] (sequence direction 5'-3')

[0074]2. Preparation of the BK virus DNA polymerase chain reaction solution: mix the components (primers, probes and reaction buffer) together in a certain proportion. Single reaction polymerase chain reaction solution includes 2.5 μl of 10× reaction buffer, 0.5 μl of BKV-F (10 μM), 0.25 μl of BKV-R (10 μM), 0.5 μl of BKV-P (10 μM), 2.0 μl of dNTP, and finally use Sterile ultrapure water was used to make up the reaction system to 19.8 μl.

[0075] 3...

Embodiment 2

[0087] The construction of embodiment 2 BKV quantitative standard substance I-IV:

[0088] (1) Preparation of detection reaction system: PCR reaction solution 19.8 μl, DNA polymerase 0.2 μl, purified virus genome 5.0 μl, perform PCR reaction, the reaction conditions of PCR reaction are: 94°C, 4 minutes; 94°C, 15 seconds; 60°C, 35 seconds, 40 cycles;

[0089] The PCR reaction solution includes 2.5 μl of 10× reaction buffer, 0.5 μl of BKV-F (10 μM), 0.25 μl of BKV-R (10 μM), 0.5 μl of BKV-P (10 μM), 2.0 μl of dNTP, and finally use sterile ultrapure water Make up the reaction system to 19.8 μl.

[0090] (2) Inserting the amplified product into a T vector to construct a recombinant plasmid, which is transformed into bacteria and amplified.

[0091] The obtained DNA sequence was directly connected to the pSTV28 DNA vector by T4 phage DNA ligase, and the pSTV28 DNA vector was purchased from Takara Company. Then the recombinant plasmid vector was transformed into Escherichia coli ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a detection method of a virus and a kit and particularly relates to a detection method of a BK virus and a kit thereof. The detection method comprises the following steps of: firstly, designing specific primers BKV-F and BKV-R and a Taqman fluorescence probe BKV-P aiming at a BK virus gene group; marking a fluorophore on a 5' end of the Taqman fluorescence probe BKV-P andmarking a quencher at any position the Taqman fluorescence probe BKV-P except the 5' end; then treating a sample to be detected and carrying out PCR (Polymerase Chain Reaction); and finally, detecting a reaction result by using a fluorescent quantitation PCR instrument. The detection method disclosed by the invention has the advantages that the qualitative and quantitative detection can be realized, and high sensibility, good specificity, rapid reaction and low cost also can be realized. The invention further relates to a detection kit of the BK virus and an application of the detection method.

Description

technical field [0001] The invention relates to a virus detection method and a kit, in particular to a BK virus detection method and a kit. Background technique [0002] BK virus (BKV) is a kind of polyomavirus (Polyomaviruses), the primary infection mostly occurs in childhood, and the adult BK virus seropositive rate is as high as 80%. After primary infection, the virus mainly exists in the kidney tissue and urothelial tissue in a latent state. In addition, there are also latent viruses in the lymphatic tissue, liver, lung, eye, and brain. People with normal immunity are asymptomatic. When the host immune function is reduced or suppressed, the virus can reactivate replication and cause disease. Long-term use of anti-rejection drugs (immunosuppressants) after organ transplantation leads to low immune function in patients, which is the main cause of BK virus activation and replication. BK virus-associated nephropathy (BKVAN) can be caused by BK virus infection in 6-10% of k...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
Inventor 石炳毅钱叶勇蔡明宋玉亮韩永王新颖范宇解俊杰叶锋
Owner THE 309TH HOSPITAL OF CHINESE PEOPLES LIBERATION ARMY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com