Xylose isomerase producing method
A technology of xylose isomerase and gene is applied in the field of producing recombinant xylose isomerase and constructing microbial engineering bacteria to produce recombinant enzyme, so as to achieve the effect of improving performance and saving raw materials
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] 1.1 Construction of Pichia pastoris expression vector
[0025] 1.1.1 Construction of cloning vector
[0026] A professional DNA sequence synthesis company synthesizes two base-complementary double strands containing ampicillin (AMP) gene sequence, polyclonal linker and E. coli replication origin, and forms cohesive ends at both ends of each DNA strand sequence. It is circularized by the action of DNA ligase to form a DNA cloning vector. named its cloning vector as pPM
[0027] 1.1.2 Acquiring genes
[0028] ①PCR amplification of the xylose isomerase gene of Thermus sp.
[0029] Primer 1:
[0030] 5'GC GAATTC ATGTACGAGCCCAAACCGG3'[Description. The 8 bases at the 5' end are enzyme-cleaved protection bases (2 small bases) and DNA restriction endonuclease recognition sites (the 6 underlined bases are enzyme recognition sites)]
[0031] Primer 2:
[0032] 5'CA GCGGCCGC TTA CCCCCGCACCCCCAGGAGGTACTCCACC3'[Explanation: 10 bases of 5' are restriction enzyme protectio...
Embodiment 2
[0085] 2.1 Construction of Saccharomyces cerevisiae expression vector
[0086] 2.1.1 Construction of cloning vector
[0087] A professional DNA sequence synthesis company synthesizes two base complementary double strands containing ampicillin (AMP) gene sequence, polyclonal adapter and E. coli replication origin, and forms cohesive ends at both ends of each DNA strand sequence. It is circularized by the action of DNA ligase to form a DNA cloning vector. The cloning vector was named pSM.
[0088] 2.1.2 Acquiring genes
[0089] ①PCR amplification of the xylose isomerase gene of Thermus sp.
[0090] Primer 1:
[0091] 5'GC GAATTC ATGTACGAGCCCAAACCGG3'[Description: The 8 bases at the 5' end are enzyme-cleaved protection bases (2 bases) and DNA restriction endonuclease recognition sites (the 6 bases underlined are enzyme recognition sites)]
[0092] Primer 2:
[0093] 5'CA GCGGCCGC TTA CCCCCGCACCCCCAGGAGGTACTCCACC3'[Explanation: 10 bases of 5' are restriction enzyme pro...
Embodiment 3
[0148] 3.1 Construction of Bacillus subtilis expression vector
[0149] 3.1.1 Construction of cloning vector
[0150] A professional DNA sequence synthesis company synthesizes two base-complementary double strands containing ampicillin (AMP) gene sequence, polyclonal linker and E. coli replication origin, and forms cohesive ends at both ends of each DNA strand sequence. It is circularized by the action of DNA ligase to form a DNA cloning vector. named its cloning vector as pBM
[0151] 3.1.2 Acquiring genes
[0152] ①PCR amplification of the xylose isomerase gene of Thermus sp.
[0153] Primer 1:
[0154] 5'GC GAATTC ATGTACGAGCCCAAACCGG3'[Description: The 8 bases at the 5' end are enzyme-cleaved protection bases (2 bases) and DNA restriction endonuclease recognition sites (the 6 bases underlined are enzyme recognition sites)]
[0155] Primer 2:
[0156] 5'CA GCGGCCGC TTA CCCCCGCACCCCCAGGAGGTACTCCACC3'[Explanation: 10 bases of 5' are restriction enzyme protection ba...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
