Application of Arabidopsis transcription factor in breeding drought-resistant salt-tolerant rice

A technology of transcription factor, drought resistance and salt tolerance, applied in the field of plant biology, can solve the problems of breeding time and breeding limitations of excellent characters

Inactive Publication Date: 2012-11-14
UNIV OF SCI & TECH OF CHINA
View PDF4 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In order to solve the problem that the cultivation of drought-tolerant rice varieties is limited by the breeding time and the selection of excellent traits, the present invention provides a use of Arabidopsis transcription factors in the cultivation of drought-resistant and salt-tolerant rice

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Arabidopsis transcription factor in breeding drought-resistant salt-tolerant rice
  • Application of Arabidopsis transcription factor in breeding drought-resistant salt-tolerant rice
  • Application of Arabidopsis transcription factor in breeding drought-resistant salt-tolerant rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment one, rice callus induction

[0039] 1) Hull the half-ripe rice seeds, carefully remove the moldy grains, take the plump and clear grains and soak them in 70% ethanol (surface disinfection) for 1-1.5 minutes, and then use NaClO with 2% active chlorine content Solution (add 1-3 drops of Tween20), put it into a shaker at 120rpm and shake for 45min, then rinse the treated seeds with sterile distilled water 4-5 times;

[0040] 2) Put the sterilized seeds in 30mL NB containing 2.0mg / L 2,4-D 0 Surface of solid callus induction medium (see below for medium composition);

[0041] 3) Wrap the plate with the medium containing the seeds in a parafilm and incubate in the dark at 25±1°C;

[0042] 4) Culture in the dark for about 10 days, induce the primary callus, peel it off, and then subculture 1-2 times in the same fresh callus induction medium until vigorously growing light yellow brittle embryos are obtained. callus formed. The above-mentioned immature embryo-indu...

Embodiment 2

[0043] Example 2. Isolation and cloning of MYB44 gene

[0044] The sequence designed in the present invention comes from NCBI (http: / / www.ncbi.nih.gov / ), Gene ID in NCBI: 836865, in the Arabidopsis Resource Center, its site (AT5G67300) and sequence information are as follows The website shall prevail (http: / / www.arabidopsis.org / servlets / TairObject?id=132479&type=locus), the template used is the cDNA of Arabidopsis thaliana seedlings and roots, according to its site information AT5G67300, we will abbreviate it It is A300; when performing PCR, add 10 ng of Arabidopsis seed cDNA in 50 μL system as a template, and react with 20 pmoles of each of the above primers. The reaction conditions were: 94°C (1 min) pre-denaturation; then 94°C (30 sec), 58°C (30 sec), 72°C (1 min) for a total of 35 cycles; finally 72°C extension for 10 min, the Taq enzyme used High-fidelity PfuTaq enzyme. The primers used were A300FP: AGGATGTTCGCGCGAAGACTCTCCTC; A300RP: GGAAAGCGAAGAAGCG GTAAAGCTC. The am...

Embodiment 3

[0045] Embodiment three, the construction of rice expression vector and its genetic transformation

[0046] After the intermediate plasmid is obtained, it is cloned into the rice expression vector pCAB through a recombined LR reaction, and then screened by PCR. The promoter used in the rice vector is the Actin1 promoter of rice. In bacteria it is kanamycin resistance, in rice it is herbicide resistance PPT or Bar resistance. The specific method is as follows: Add about 75 ng of pCAB vector plasmid DNA, about 150ng of pDGA300 intermediate vector plasmid DNA, and 1 μL of invitrogen LR Clonase into the reaction system TM II, and add TE Buffer, pH 8.0 to make up to 5 μl, react at 25 ℃ for 1 hour. The reaction product was transformed into Escherichia coli competent cells by heat shock method, and the positive clone pCBA300 was obtained by screening.

[0047] The above-mentioned vector pCBA300 was introduced into the rice variety Wanjing 97 (provided by Anhui Academy of Agricultu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to application of Arabidopsis transcription factor in breeding drought-resistant salt-tolerant rice. Nucleotide sequences of the Arabidopsis transcription factor MYB44 are shown in SEQ ID NO.1. Encoded protein sequences of the Arabidopsis transcription factor MYB44 are shown in SEQ ID NO.2. Conditions that are met for the nucleotide sequences and the encoded protein sequences include: first, DNA (deoxyribonucleic acid) sequences shown on the 88th site to the 1005th site in the sequence table SEQ ID NO.1, or the sequences highly homologous to the DNA sequences shown on the 88th site to the 1005th site in the SEQ ID NO.1; second, other encodable sequencecs with the same protein as the DNA sequences shown in the sequence table SEQ ID NO.2; third, the sequences the same functional as the DNA sequences shown on the 88th site to the 1005th site in the SEQ ID NO.1, or sub-segments contained in the highly homologous DNA sequences shown on the 88th site to the 1005th site in the SEQ ID NO.1. The Arabidopsis transcription factor is applied to breeding of the drought-resistant salt-tolerant rice. An expression vector of the MYB44 gene can be introduced into plant cells by biotechnology. Transforming hosts, available to use the expression vector containing the MYB44 gene, can be monocotyledons such as rice, corn and wheat. The Arabidopsis transcription factor is also applicable to dicotyledons such as tobacco and soybean. The Arabidopsis transcription factor is used to breed drought-resistant salt-tolerant plant varieties.

Description

technical field [0001] The invention belongs to the field of plant biotechnology, and in particular relates to the separation and cloning, transformation, functional verification and application of a DNA fragment (gene) of an Arabidopsis transcription factor and rice. In particular, it relates to the application and method of using the gene to enhance the stress resistance of rice such as drought resistance and salt tolerance. Background technique [0002] Drought and salinity are two important adversity factors that affect agricultural production and ecological environment in the world today, and cause huge losses to world food production. Under the severe pressure of increasing population, decreasing arable land and insufficient fresh water resources, how to efficiently use limited fresh water resources for maximum agricultural production is one of the major issues that international and domestic bioscience and technology urgently need to solve. Rice is the most water-int...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/82C12N15/84A01H5/00
Inventor陈学平汪洋曹树青郭家明李敏张银萍
OwnerUNIV OF SCI & TECH OF CHINA