Application of transcription factor NFATC3 as drug target in reversing multidrug resistance of tumor
A transcription factor and multi-drug resistance technology, which is applied in the direction of antineoplastic drugs, drug combinations, medical preparations containing active ingredients, etc., can solve problems such as unseen applications, and achieve the effect of less toxic and side effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1 Detection of MDR1 mRNA transcription level in multidrug resistant tumor cells
[0026] experimental method:
[0027] Take MCF-7 / WT and MCF-7 / ADM 1×10 each 5 And extract the total RNA of the above cells according to the method described in the Trizol Reagent reagent operating instructions; reverse transcribing the total RNA of the above extracted cells according to the method described in the reverse transcription kit iScript TM cDNA Synthesis Kit operating instructions to obtain cDNA , The reverse transcription primer is the universal primer that comes with the above kit.
[0028] Real-time fluorescence quantitative PCR was used to detect the mRNA transcription level of P-gp in MCF-7 / WT and MCF-7 / ADM. Real-time PCR amplification is performed on the iCycler iQ fluorescent quantitative PCR instrument. Fluorescence quantitative PCR primer design: upstream primer is 5'-GCCGGGAGCAGTCATCTGTGG T-3', downstream primer is 5'-GAT CCA TTCCGACCTCGCGCT-3'; fluorescent quantita...
Embodiment 2
[0031] Example 2 Prediction and confirmation of the binding of transcription factor NFATC3 to the MDR1 promoter region
[0032] experimental method:
[0033] The transcription factor binding site prediction software TESS (Transcription Elemen Search System) was used to predict the binding site of NFATC3 and MDR1 promoter region.
[0034] Take MCF-7 / WT and MCF-7 / ADM as samples, and detect the binding of NFATC3 to the MDR1 promoter according to the method described in the chromatin Immunoprecipitation Assay kit operating instructions of the nucleic acid protein precipitation kit, that is, first use chromosome immunoprecipitation (CHIP) Technology to precipitate chromatin fragments bound to the target protein, and then detect the precipitated chromatin fragments by PCR. Set up an experimental group and a control group. The experimental group uses NFATC3 antibody as the incubation antibody, and the control group uses New Zealand rabbit preimmune serum IgG (purified by protein G affinit...
Embodiment 3
[0037] Example 3 The activation of the transcription factor NFATC3 by extracellular calcium influx mediated by TRPC5
[0038] experimental method:
[0039] HEK293 cells capable of stably expressing TRPC5 were seeded on a 24-well plate at a density of 30,000 cells per well, and placed in 5% CO 2 After culturing for 12 hours in a constant temperature cell incubator, the co-transfection was carried out. The co-transfection system was: 0.2 μg reporter plasmid (mdr1-luc or NFAT binding site deletion plasmid ΔTTTTCC-mdr1-luc, of which ΔTTTTCC-mdr1-luc was used for targeted Mutation kit Quick Change Site-directed Mutagenesis Kit is obtained by deleting and mutating the bases in the binding site region predicted by TESS in Example 2 according to the method described in the kit operating instructions. Primer design: the upstream primer is 5'- GTAAACAAATGAATTTCCATAAAGCTAATTTATCTTTATAATACTTATTACTTCAAATTCTTGTTACATTT-3', the downstream primer is 5'-AAATGAACAA GAATTTGAAGTAATAAGTATTATAAAGATAAATTA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More