Brachymystax lenok Cathelicidin antimicrobial peptide CATH_BARLE, and gene, preparation and application thereof
A technology of antimicrobial peptides and leptospirosis, applied in the field of biomedicine, can solve problems such as the short history of cathelicidin research
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Cloning and gene sequencing of antimicrobial peptide CATH_BRALE precursor gene, including:
[0041] Using RNeasy AxyPrep TM Multisource Total RNA Miniprep Kit (Qiagen, union city, CA, USA) was used to extract total RNA from the spleen of leptospirosis, and the mRNA was isolated and purified using the PolyATtract® mRNA Isolation Systems kit from PROMEGA, USA. The In-Fusion? SMARTer Directional cDNA Library Construction Kit was used to construct the Leptospirosis bone marrow cDNA library. PowerScript Reverse Transcriptase reverse transcription to synthesize the first strand of cDNA, the primers are:
[0042] Forward SMARTer V Oligonucleotide Primer: 5'–AAGCAGTGGTATCAACGCAGAGTACXXXXX–3' Reverse In-Fusion SMARTer CDSⅢ Primer: 5'–CGGGGTACGATGAGACACCATTTTTTTTTTTTTTTTTTTTVN–3'(N = A, C, G, or T; V = A, G, or C ).
[0043] The second strand was synthesized by Advantage DNA Polymerase, the primer was: forward 5'-AAGCAGTGGTATCAACGCAGAGTACT-3', and the reverse primer was In-Fu...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Lc50 | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 