Check patentability & draft patents in minutes with Patsnap Eureka AI!

Brachymystax lenok Cathelicidin antimicrobial peptide CATH_BARLE, and gene, preparation and application thereof

A technology of antimicrobial peptides and leptospirosis, applied in the field of biomedicine, can solve problems such as the short history of cathelicidin research

Inactive Publication Date: 2012-12-12
DALIAN UNIV OF TECH
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Since the history of cathelicidin research in the world is not long, the research on this kind of active peptide family in my country is still rarely reported.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Brachymystax lenok Cathelicidin antimicrobial peptide CATH_BARLE, and gene, preparation and application thereof
  • Brachymystax lenok Cathelicidin antimicrobial peptide CATH_BARLE, and gene, preparation and application thereof
  • Brachymystax lenok Cathelicidin antimicrobial peptide CATH_BARLE, and gene, preparation and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Cloning and gene sequencing of antimicrobial peptide CATH_BRALE precursor gene, including:

[0041] Using RNeasy AxyPrep TM Multisource Total RNA Miniprep Kit (Qiagen, union city, CA, USA) was used to extract total RNA from the spleen of leptospirosis, and the mRNA was isolated and purified using the PolyATtract® mRNA Isolation Systems kit from PROMEGA, USA. The In-Fusion? SMARTer Directional cDNA Library Construction Kit was used to construct the Leptospirosis bone marrow cDNA library. PowerScript Reverse Transcriptase reverse transcription to synthesize the first strand of cDNA, the primers are:

[0042] Forward SMARTer V Oligonucleotide Primer: 5'–AAGCAGTGGTATCAACGCAGAGTACXXXXX–3' Reverse In-Fusion SMARTer CDSⅢ Primer: 5'–CGGGGTACGATGAGACACCATTTTTTTTTTTTTTTTTTTTVN–3'(N = A, C, G, or T; V = A, G, or C ).

[0043] The second strand was synthesized by Advantage DNA Polymerase, the primer was: forward 5'-AAGCAGTGGTATCAACGCAGAGTACT-3', and the reverse primer was In-Fu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Lc50aaaaaaaaaa
Login to View More

Abstract

The invention relates to a Brachymystax lenok Cathelicidin antimicrobial peptide CATH_BARLE, and a gene, a preparation and an application thereof, and belongs to the technical field of biomedicine. The gene of the CATH_BARLE is composed of 909 nucleotides, and a part coding the mature peptide is nucleotides from the 439th bit to the 597th bit. The mature peptide CATH_BARLE is rich in alkaline amino acids, and has a strong bactericidal effect on common pathogens in aquatic product culture. The CATH_BARLE has a simple structure, does not contain a disulfide bond or an annular structure, and is convenient for chemical synthesis and gene engineering preparation; and the CATH_BARLE also has a good killing effect on many clinical drug-resistant bacteria, especially fungi.

Description

technical field [0001] The invention provides a cathelicidin family broad-spectrum antimicrobial peptide CATH_BRALE derived from Brachymystax lenok and its gene, a preparation method and application in medical treatment, biopharmaceutical and aquaculture disease prevention, which belong to the field of biomedical technology. Background technique [0002] Cathelicidin is a family of multifunctional antimicrobial peptides composed of an N-terminal signal peptide region, a middle conserved cathelin domain and a C-terminal highly specific mature peptide region. species and fish) have been found. Like defensin, cathelicidin is a host defense peptide unique to most vertebrates including humans, which constitutes a key component of the natural immune response of vertebrates and serves as a bridge connecting natural immunity and specific immunity. Cathelicidin has broad-spectrum antibacterial activity, not only has very strong bactericidal activity against Gram-positive bacteria, G...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/46C12N15/12A61K38/17A61P31/04A61P31/10
Inventor 于海宁王义鹏厉政张嵩岩
Owner DALIAN UNIV OF TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More