Method for monitoring state of differentiation in stem cells

A stem cell and state technology, applied in the field of monitoring the differentiation state of stem cells, can solve problems such as loss of pluripotency, inability to continuously investigate cell state, and judge differentiation state

Inactive Publication Date: 2012-12-12
OLYMPUS CORP
View PDF6 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In stem cell experiments such as ES cells and iPS cells, pluripotency is maintained by co-cultivation with feeder cells and addition of LIF, but pluripotency may be lost depending on the environment or the state of the cells, and differentiation may be easy
In order to understand the differentiation induction process, it is important to accurately determine the undifferentiated state (state with pluripotency) and differentiated state, but it is difficult to judge the differentiated state only by the morphology of ES cells
[0005] Alkaline phosphatase staining and immunostaining using antibodies specific to differentiation markers were used as indicators for judging pluripotency, but both methods fix the cells, so the state of the cells cannot be continuously investigated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for monitoring state of differentiation in stem cells
  • Method for monitoring state of differentiation in stem cells
  • Method for monitoring state of differentiation in stem cells

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0098] 1. Preparation of Stem Cells for Monitoring

[0099] In the present invention, according to known techniques, the promoter region of the marker gene is fused with the luciferase gene (reporter gene), and the fusion gene is introduced into stem cells to prepare stem cells for monitoring.

[0100] A known promoter region may be used for the "promoter region of a marker gene", or it may be cloned based on the nucleotide sequence of a known marker gene. For example, the promoter region of Nanog is described in T Kuroda et al., Molecular and Cellular Biology (2005 vol.25, No.6 p2475-2485); the promoter region of Oct is described in SOkumura-Nakanishi et al., The journal of Biological Chemistry (2005 vol.280, No7p5307-5317); the promoter region of Nestin is described in L Cheng et al., FEBS Letters 2004 565p195-202.

[0101]Commercially available genes can be used for the "luciferase gene", for example, Eluc luciferase (green), CRB luciferase (red), and Renilla luciferase (b...

Embodiment 1

[0141] Example 1: Examples using undifferentiated markers

Embodiment 1-1

[0142] Example 1-1: Observation and analysis of transiently expressing cells

[0143] (1) Production of ES cells into which a fusion gene of the promoter region of the undifferentiation marker gene and the luciferase gene was introduced

[0144] Regarding the cloning of the Nanog gene promoter region, refer to the non-patent literature "T Kuroda et al., Molecular and Cellular Biology 2005 vol.25, No. 6, p2475-2485" to obtain the promoter sequence.

[0145] The sequence of the Nanog gene promoter region was obtained using mouse genome DNA as a template. As primers for amplifying the Nanog gene promoter region, the following primers were used.

[0146] Forward primer: CTACTCGAGATCGCCAGGGTCTGGA (SEQ ID NO: 1)

[0147] Reverse primer: CTACTCGAGCGCAGCCTTCCCACAGAAA (SEQ ID NO: 2).

[0148] The obtained Nanog gene promoter sequence was inserted into pGL4-basic vector (Promega) to create "Nanog gene expression-specific luminescence vector pNanog-GL4".

[0149] For culturing ES cel...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

Disclosed is a method for monitoring the state of differentiation in stem cells characterized by including a step (A-1) for culturing stem cells into which a promoter region for a differentiation state detection marker gene, photoprotein gene and fusion gene have been introduced, a step (A-2) for culturing the stem cells after that step (A-1) under conditions that induce differentiation and a step (A-3) for capturing images of luminescence due to expression of the photoprotein gene in the stem cells over at least a fixed period of time of those steps (A-1) - (A-2).

Description

technical field [0001] The present invention relates to methods of monitoring the differentiation state of stem cells. Background technique [0002] In the field of regenerative medicine, intractable diseases are expected to be treated through cell transplantation and organ regeneration using stem cells. Although clinical applications such as heart diseases have been implemented in advance, there are still many unclear points about how the transplanted stem cells actually function. In order to perform safe transplantation, it is necessary to elucidate the mechanism of stem cell differentiation induction (induction to cells with a certain specific function) and determine the factors controlling intracellular dynamics and functions. [0003] So far, it is known that stem cells express several transcription factors highly specific to undifferentiated cells at the molecular level. They include Oct-4, Sox, Nanog, Leukemia Inhibitor Factor Receptor (LIF-R). Oct-4 is expressed i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N5/10C12Q1/66C12N15/12C12Q1/02
CPCG01N33/582G01N33/5073C12Q1/66C12Q1/6897C12M41/46
Inventor大桥阳子
OwnerOLYMPUS CORP