Microorganism production of high-valve chemical products, and related compositions, methods and systems

A technology of chemical products and microorganisms, applied in the field of metabolic engineering microorganisms

Inactive Publication Date: 2012-12-12
OPX BIOTECH +1
View PDF57 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Unfortunately, previous attempts to achieve commercially viable titers by microbial synthesis of 3-HP have revealed that the microorganisms used are inhibited by 3-HP concentrations well below established commercially viable titers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Microorganism production of high-valve chemical products, and related compositions, methods and systems
  • Microorganism production of high-valve chemical products, and related compositions, methods and systems
  • Microorganism production of high-valve chemical products, and related compositions, methods and systems

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0464] Therefore, various embodiments of the present invention, such as a method of preparing a chemical, include a conversion step to any such downstream product of 3-HP produced by a microorganism, including but not limited to this article and incorporated references (For regions where the latter is permitted) those chemicals described in the section. For example, one embodiment is to prepare a 3-HP molecule according to the teachings herein, and further convert the 3-HP molecule into polymerized -3-HP (poly-3-HP) or acrylic acid, and for example from the 3-HP molecule The produced acrylic acid is prepared by any of the following: polyacrylic acid (polymerized acrylic acid, in various forms), methyl acrylate, acrylamide, acrylonitrile, propiolactone, ethyl 3-HP, malonic acid, 1,3- Propylene glycol, ethyl acrylate, n-butyl acrylate, hydroxypropyl acrylate, hydroxyethyl acrylate, isobutyl acrylate, 2-ethylhexyl acrylate, and alkyl or aryl groups added thereto and / or added there...

Embodiment 1

[0506] Example 1: Construction of a plasmid expressing malonyl-CoA reductase (mcr)

[0507] According to the service of a commercial DNA gene synthesis provider-DNA2.0 (Menlo Park, CA USA), the nucleotide sequence of the malonyl-CoA reductase gene from Chloroflexus orange was encoded against E. coli Sub-optimization. The gene sequence (SEQ ID NO: 803) introduced an EcoRI restriction site before the start codon and followed by a HindIII restriction site. In addition, a ribosome binding site is set before the start codon. The gene construct was synthesized by DNA2.0 and provided in the pJ206 vector backbone (SEQ ID NO: 804). The plasmid DNA pJ206 containing the synthetic mcr gene was restriction digested with the enzymes EcoRI and HindIII obtained from New England BioLabs (Ipswich, MA USA) according to the manufacturer's instructions. The digestion mixture is separated by agarose gel electrophoresis and the appropriate DNA fragments are recovered as described in the Common Metho...

Embodiment 2

[0511] Example 2: Construction of a plasmid expressing transhydrogenase (pntAB)

[0512] Inducer-independent E. coli promoter derived from the tpiA gene (P tpi A) A fusion with the pyridine nucleotide transhydrogenase gene pntAB (SEQ ID NO: 779 and SEQ ID NO: 781) was created as follows: the tpiA promoter region and pntAB region were amplified from genomic E. coli K12 DNA by polymerase chain reaction . For the pntAB gene, use the pntAB forward primer GGGAACCATGGCAATTGGCATACCAAG (SEQ ID NO: 807, note that all primers disclosed herein are artificial sequences) and the pntAB reverse primer GGGTTACAGAGCTTTCAGGATTGCATCC (SEQ ID NO: 808) to amplify the region, the pntAB The forward primer contains a NcoI site that introduces the starting Met for the pntA protein sequence. Similarly, the PtpiA region was amplified using the forward primer GGGAACGGCGGGGAAAAACAAACGTT (SEQ ID NO: 809) and the reverse primer GGTCCATGGTAATTCTCCACGCTTATAAGC (SEQ ID NO: 810) containing the NcoI restriction s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Titeraaaaaaaaaa
Login to View More

Abstract

This invention relates to metabolically engineered microorganism strains, such as bacterial strains, in which there is an increased utilization of malonyl-CoA for production of a chemical product, which includes polyketides and 3-hydroxypropionic acid.

Description

[0001] Cross reference of related applications [0002] This application claims priority for the U.S. Provisional Application 61 / 298,844 filed on January 27, 2010 and the U.S. Provisional Application 61 / 321,480 filed on April 6, 2010. The entire content of each application is hereby incorporated in its entirety for reference. [0003] Statement on Federally Funded Development [0004] The present invention was made under the government support of DE-AR0000088 granted by the U.S. Department of Energy and the government support of BES0228584 and BES0449183 granted by the National Science Foundation. The government has certain rights in this invention. Technical field [0005] The present invention relates to metabolically engineered microorganisms, such as bacterial strains, in which there is an increased utilization of malonyl-CoA for the production of chemical products, which may include polyketide chemicals. In addition, the biosynthetic pathways in microorganisms can be geneticall...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P7/00
CPCC12N9/93C12P7/66C12N9/88C12P19/623C12N9/0008C12Y604/01002C12P17/18C12P19/62C12N9/0036C12P7/52C12P29/00C12P19/44C12P7/00C12N15/52C12M3/02C12P7/42C12P21/005
Inventor迈克尔·D·林奇R·T·吉尔坦尼娅·瓦尼克-利普斯科布
OwnerOPX BIOTECH