Recombinant fusion protein PTD-HSP27 and use thereof

A technology of fusion protein and gene, applied in the field of genetic engineering, to achieve the effect of inhibiting apoptosis, improving the route of medication, and expanding the scope of application

Inactive Publication Date: 2012-12-19
钟敬祥
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, no one has used the delivery function of PTD to transport HSP27 into the eye, and used PTD-HSP27 to act on various types of cells in the eye, so as to delay the occurrence and development of eye diseases such as cataract, and there is no related report

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant fusion protein PTD-HSP27 and use thereof
  • Recombinant fusion protein PTD-HSP27 and use thereof
  • Recombinant fusion protein PTD-HSP27 and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Preparation of recombinant fusion protein PTD-HSP27

[0027] The preparation of the recombinant fusion protein PTD-HSP27 in this example is prepared by conventional gene recombination method.

[0028] (1) Amplification of PTD-HSP27-6HIS gene

[0029] The present invention designs and synthesizes two primers to amplify the PTD-HSP27-6HIS gene (SEQ ID NO: 2) by PCR method. Using primer suspension, PTD short peptide YGRKKRRQRRR was introduced into the N-terminus of the HSP27 gene, and 6 histidine tags were introduced into the C-terminus. On the basis of the existing HSP27 gene, the PTD-HSP27-6His gene was synthesized. The nucleotide sequence of primer 1 is 5'-XXXXXX CATATG TATGGCCGTAAAAAACGTCGTCAGCGTCGTCGTACCGAG CGCCGCGTCCCCTTCTCGCTC-3', the nucleotide sequence of primer 2 is 5'-XXXXXX CTCGAG TTATCAATGATGATGATGATGATGCTTGGCGGCAGTCTCATCGGATT-3', in the above two primers, X represents the protected base, CATATG is the NdeI restriction site, CTCGAG It is ...

Embodiment 2

[0040] Example 2 Functional detection of recombinant fusion protein PTD-HSP27 (SEQ ID NO: 1) penetrating cell membrane

[0041] Use fluorescein isothiocyanate (FITC) labeling kit (commercially available) to fluorescently label PTD-HSP27, the steps are as follows:

[0042] 1. FLOUS in the FITC kit is dissolved in DMF (2mg / 0.2ml) to form a fluorescein solution;

[0043] 2. PBS dissolves the fusion protein PTD-HSP27, and the final concentration is ≥4mg / ml;

[0044] 3. Mix the fluorescein and the fusion protein PTD-HSP27 at a ratio of 1:8 (V / V), react in the dark for 2 hours at room temperature, and shake 4 times intermittently;

[0045] 4. After adding 2 ml of PBS, shake the gel column to suspend the deposited gel, fix the gel column upright, and continuously and slowly add 30 ml of PBS to balance the column;

[0046] 5. Pass the above 3 reaction solution through the gel column, elute with 0.8 ml of PBS, discard the eluate, elute with 1 ml of PBS, collect 1 ml of the marker ...

Embodiment 3

[0048] Example 3 Anti-apoptotic effect of recombinant fusion protein PTD-HSP27 (SEQ ID NO: 1) on human lens epithelial cells

[0049] (1) UV irradiation LEC time screening

[0050] Human LEC cells in the logarithmic growth phase were taken, and the cell culture medium was aspirated before irradiation, and washed once with PBS. Placed at 10 cm under the ultraviolet light source, the irradiation time was 0s, 5s, 10s, 20s, 30s, 1min. Cell apoptosis rate was detected by flow cytometry ( image 3 ), suggesting that the apoptosis rate of LEC cells was close to half after 30s of ultraviolet irradiation, and the ultraviolet irradiation time of 30s was chosen as the unified irradiation time for subsequent experiments.

[0051] (2) Screening of optimal incubation concentration of recombinant fusion protein PTD-HSP27

[0052] Prepare 20× PTD-HSP27 recombinant fusion protein stock solution with a concentration of 10 μM (ie 0.27 mg / ml). The protein stocks were diluted respectively to...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses recombinant fusion protein PTP-HSP27 and use thereof; an amino acid sequence is SEQ ID NO.1; the recombinant fusion protein PTP-HSP27 disclosed by the invention not only has the biological activity of HSP27, but also has a transcellular barrier transportation function; the recombinant fusion protein PTP-HSP27 can effectively perforate into lenticular epithelial cells (LEC); the apoptosis of the lenticular epithelial cells is alleviated; and the development and progression of cataract is delayed greatly. According to the invention, the recombinant fusion protein PTP-HSP27 endows the transcellular barrier transportation function of PTD to the HSP27, thus, the HSP27 easily perforates the cell barrier of corneas and effectively enters eyes through cornea tissues; and the application range of the recombinant fusion protein PTD-HSP27 in an eye part is expanded.

Description

technical field [0001] The present invention relates to the field of genetic engineering, specifically to the field of design and recombinant fusion protein technology, in particular to a recombinant fusion protein PTD-HSP27 and its application. Background technique [0002] Cataract, a disease that occurs on the lens inside the eye, is the most common cause of blindness and visual impairment. Analyzing and exploring the development process and pathogenesis of cataract, and developing effective drugs for the prevention and treatment of cataract have important social benefits. Studies have confirmed that apoptosis is earlier than cataract in space and time, and it is deduced that lens epithelial cell apoptosis may be the common cellular basis of various cataracts. The mechanism of cell apoptosis believes that if the epithelial cells undergo apoptosis, the growth of the lens will stagnate, and the lens epithelial cells (LEC) will fall off, which will lead to a series of chang...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/63C12N1/21A61K38/17A61K47/48A61P27/12
Inventor钟敬祥余榕捷刘莲戴云施月欢
Owner钟敬祥