Genetic engineering bacterium for producing succinic acid, and construction and application thereof

A genetically engineered bacteria and a technology for producing succinic acid, applied in the field of bioengineering, can solve problems such as growth inhibition, inability to utilize glucose, etc., and achieve the effects of strong acid-producing ability, simple and feasible fermentation method, and reduced production cost.

Active Publication Date: 2013-01-09
NANJING UNIV OF TECH
View PDF6 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Deletion of the pyruvate formate lyase gene PPML and lactate dehydrogenase gene wxya , leading to a large accumulation of pyruvate, which feedback inhibits the transport of glucose by the PTS sugar transport system, so that the bacteria cannot use glucose under anaerobic conditions, and the growth is inhibited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic engineering bacterium for producing succinic acid, and construction and application thereof
  • Genetic engineering bacterium for producing succinic acid, and construction and application thereof
  • Genetic engineering bacterium for producing succinic acid, and construction and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Construction of plasmid pTrc99a- expressing exogenous pyruvate carboxylase pyc The process includes:

[0041] 1. Synthesis with Nco I and Pst Primers for I restriction sites:

[0042] Upstream primer: 5'- CATGCCATGGTCAGCTGATGAGAAACGTCGAGAAG -3';

[0043] Downstream primer: 5'- AAAACTGCAGGGTCATTCTCTTCAAAGCCAAAACGA-3'.

[0044] 2. to Lactococcus lactis cremoris NZ9000 genomic DNA was used as a template, and the target gene fragment was amplified by PCR. The reaction conditions were: 94°C, 5 min; (94°C for 45 s, 53°C for 45 s, 72°C for 300 s, 35 cycles); 72°C, 10 min. purified amplified pyc After the gene, the expression plasmid pTrc99a was used Nco I double digestion, connection to obtain recombinant plasmid pTrc99a- pyc .

Embodiment 2

[0045] Example 2 Construct an expression plasmid that overexpresses pyruvate carboxylase and nicotinic acid phosphoribosyltransferase, restore the ability of the recombinant strain to metabolize glucose under anaerobic conditions, and obtain the strain Escherichia coli BA016.

[0046] 1. Construction of an expression plasmid for excessive co-expression of pyruvate carboxylase and nicotinic acid phosphoribosyltransferase, the process including:

[0047] (1) Both upstream and downstream primers are synthesized with Nco Primers for I restriction sites,

[0048] Upstream primer: 5'-CATGCCATGGGAAAGGTGGCATATGGTGTGATCGG-3';

[0049] Downstream primer: 5'-CATGCCATGGCGGCTACAGGCACAACGCTCATAAT -3'.

[0050] (2) Using the Escherichia coli K12 series as a template, amplify the target gene fragment by PCR. The reaction conditions are: 94°C, 5 min; (94°C for 45 s, 63°C for 45 s, 72°C for 96s, 35 cycles); 72°C , 10 min. purified amplified pncB After the gene, the plasmid pTrc99a-...

Embodiment 3

[0052] Example 3 Overexpression of newly constructed recombinant E. coli strains Escherichia coli The total amount of NAD(H) and NADH / NAD in BA016 and starting strain NZN111 + The comparison of the ratio, and the comparison of the sugar consumption and acid production capacity during the fermentation process of the two.

[0053] Escherichia coli NZN111 when introduced into plasmid pTrc99a- pyc - pncB Finally, the overexpression of pyruvate carboxylase and nicotinic acid phosphoribosyltransferase restored the redox balance of the recombinant bacteria under anaerobic conditions, and the total amount of NAD(H) was significantly increased, and it also restored the redox balance of the recombinant bacteria under anaerobic conditions. The ability to metabolize glucose, while the main product is succinic acid, without the accumulation of formic acid and lactic acid.

[0054] Using anaerobic serum bottle fermentation, Escherichia coli BA016 was inoculated into the fermentation...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a genetic engineering bacterium strain for producing succinic acid. The genetic engineering bacterium strain is named as Escherichia coli BA016, the preserving number registration number CCTCC NO is M 2012350. The invention further provides a construction method of the strain and a method for producing succinic acid by fermentation, recombinant escherichia coli can grow by glucose metabolism through joint excessive expression of exogenous pyruvic carboxylase and nicotinic acid ribose phosphate transferase, generation of by-product pyruvic acid is reduced, and accordingly the yield and production intensity of succinic acid are greatly improved.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and relates to a succinic acid-producing genetically engineered bacterium and its construction and application, in particular to a genetically engineered bacterium that efficiently utilizes glucose to grow and produce succinic acid Escherichia coli Construction of BA016 and method for its production of succinic acid. Background technique [0002] Succinic acid, commonly known as succinic acid, as a common natural organic acid, widely exists in animals, plants and microorganisms, and many anaerobic microorganisms produce succinic acid as the main end product of their energy metabolism. As an excellent C4 platform compound, succinic acid can be widely used in pharmaceuticals, fine chemical products and biodegradable polymers. The report of the US Department of Energy listed succinic acid as the 12 most potential in the future. No. 1 among bio-based bulk chemicals.. Many anaerobic microorg...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/70C12P7/46C12R1/19
Inventor姜岷陈旭梁丽亚万青苟冬梅刘嵘明马江锋
OwnerNANJING UNIV OF TECH