Human-mouse chimeric antibody of anti-human tumor necrosis factor related apoptosis-inducing ligand receptor DR5, preparation method and uses thereof

An apoptosis-inducing ligand, tumor necrosis factor technology, applied in the direction of anti-tumor drugs, anti-animal/human immunoglobulins, antibodies, etc., can solve the problems of weakening the treatment effect, harmful to the human body, etc., to inhibit the formation of human tumor cells effect of tumor

Inactive Publication Date: 2013-01-30
OBIO TECH SHANGHAI CORP LTD
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the monoclonal antibody prepared by hybridoma technology is a mouse-derived heterologous immunoglobulin, which may cause human anti-mouse anti

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human-mouse chimeric antibody of anti-human tumor necrosis factor related apoptosis-inducing ligand receptor DR5, preparation method and uses thereof
  • Human-mouse chimeric antibody of anti-human tumor necrosis factor related apoptosis-inducing ligand receptor DR5, preparation method and uses thereof
  • Human-mouse chimeric antibody of anti-human tumor necrosis factor related apoptosis-inducing ligand receptor DR5, preparation method and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

experiment example 1

[0063] Experimental Example 1 Construction of a new eukaryotic expression vector for highly expressing anti-DR5 human-mouse chimeric antibody with CAG promoter and dhfr selection marker

[0064]Anti-human DR5 single-chain antibody (scFv) prokaryotic expression vector pET15b-AD5scFv DNA (Guo Y et al., A novel anti-human DR5 monoclonal antibody with tumoricidal activity induces caspase-dependent and caspase-independent cell death J Biol Chem 2005; 280 (51): 41940-52) as a template, PCR amplification of the heavy chain variable region and light chain variable region gene fragments of the anti-DR5 chimeric antibody (VH primer, heavy chain: upstream primer VHE: 5'CGGAATTCCAGATCCAGTTG3'( SEQ ID NO: 10), downstream primer VHS: 5'ATGTGTCGACGCTGAGGAGACTGT3' (SEQ ID NO: 11). VL primer, light chain: upstream primer VLE: 5'GCGGAATTCGATGTTGTGATG3' (SEQ ID NO: 12), downstream primer VLS: 5 'ACGCGTCGACCCGTTTTTATTTC3' (SEQ ID NO: 13), was inserted into the vector (pCI-neo, Promega Co., E1841)...

experiment example 2

[0072] Experimental Example 2 Establishment of a CHO cell line that efficiently and stably expresses a chimeric antibody

[0073] The constructed eukaryotic expression vector pcDNA3-CAG-HF2AL-dhfr was transfected into CHO-dhfr by lipofection method - Cells (purchased from ATCC, CRL-9096) were screened for positive monoclonal clones by selection medium IMDM (HyClone, SH30228.01B) without hypoxanthine and thymine, and cell lines stably expressing chimeric antibodies were obtained. Methotrexate MTX (5 x 10 -8 -5×10 -7 mol / L) pressurized screening to obtain a cell line stably expressing the chimeric antibody with significantly improved expression yield. see results figure 2 . The cell line was preserved in the General Microorganism Center (CGMCC) of the China Committee for Culture Collection of Microorganisms on June 15, 2011. Its classification name is CHO cell line stably expressing anti-DR5 human-mouse chimeric antibody, and its number is: CGMCC No. 4938. The chimeric an...

experiment example 3

[0074] Experimental Example 3 Determination of specific binding of chimeric antibody to its antigen by enzyme-linked immunoassay (ELISA)

[0075] Coat 96-well ELISA plates with recombinant human DR5 expressed in Escherichia coli, block with 5% skimmed milk powder, and add different concentrations (0, 7.8, 15.6, 31.2, 62.5, 125, 250, 500, 1000, 2000, 4000ng / ml) chimeric antibody or mouse-derived anti-DR5 antibody, incubated at 37°C for 2 hours. Horseradish peroxidase (HRP)-labeled goat anti-human / mouse IgG secondary antibody (Zhongshan Jinqiao) was added and incubated at 37°C for 2 hours. Add the chromogenic substrate, after 30 minutes, add 2 M sulfuric acid to terminate the reaction, and measure the OD value. see results image 3 , the results showed that the binding of the chimeric antibody Zaptuximab to DR5 showed a typical single-site binding mode, Kd=1.1nM, and the affinity was not significantly lower than that of the mouse-derived anti-DR5 antibody AD5-10.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention provides a human-mouse chimeric antibody of an anti-human tumor necrosis factor related apoptosis-inducing ligand (TRAIL) receptor DR5, a preparation method and uses thereof. Specifically the present invention relates to a human-mouse chimeric antibody of an anti-human TRAIL receptor extracellular region, wherein the human-mouse chimeric antibody comprises a variable region of a mouse antibody IgG and a constant region of a human antibody IgG. The present invention further relates to a stable cell line expressing the human-mouse chimeric antibody of the anti-human TRAIL receptor extracellular region, a recombinant eukaryotic expression vector for stably expressing the human-mouse chimeric antibody, a method for preparing the human-mouse chimeric antibody, and uses of the human-mouse chimeric antibody and a composition thereof. The human-mouse chimeric antibody provides good affinity for the DR5 extracellular region, provides special apoptosis-inducing activity for tumor cells, can be used separately or be combined with other drugs, and can be used for treatments of a plurality of tumors and other DR5 related diseases.

Description

technical field [0001] The present invention relates to a human-mouse chimeric antibody against human tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) receptor (death receptor 5, DR5), and highly efficient expression of the antibody The eukaryotic expression vector, the stable cell line producing the antibody, the method for preparing the human-mouse chimeric antibody and the application of the human-mouse chimeric antibody and its composition. Background technique [0002] Death receptor 5 (death receptor 5, DR5) is a receptor for tumor necrosis factor related apoptosis-inducing ligand (TRAIL), and its intracellular region contains a death domain. DR5 combined with the natural ligand TRAIL can effectively activate the apoptosis signal transduction pathway, resulting in cell death. Previous studies have shown that mouse-derived functional anti-DR5 monoclonal antibodies can induce the death of various tumor cells cultured in vitro, effectively inhibit tumor gr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K16/46C07K16/28C12N5/10C12N15/79A61K39/395A61K48/00A61P35/00A61P35/02C12R1/91
Inventor 邱宇鹤刘彦信史娟郑德先
Owner OBIO TECH SHANGHAI CORP LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap