Fusion protein of human interferon and targeting peptide, and preparation thereof
A technology of fusion protein and interferon, which is applied in the field of fusion protein of human interferon and targeting peptide and preparation thereof, can solve the problems of intolerance of patients, large side effects, lack of targeting, etc., achieves good effect and is easy to prepare , anti-tumor effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0074] Artificial synthesis of gene fragments:
[0075] According to the codon usage frequency table of Escherichia coli, the codons highly expressed in Escherichia coli were selected, the gene sequences of IFNα-2b and targeting peptide S1 were artificially designed, and the synthesis was entrusted to Shanghai Sangon Bioengineering Co., Ltd.
[0076] Obtaining fusion gene fragments:
[0077] The upstream and downstream primers of human IFNα-2b and the upstream and downstream primers of S1 with Nde I and BamH I restriction sites are designed in sections, and the primer sequences are as follows:
[0078] Primer sequence: shaded sites for restriction restriction.
[0079] IS 1up 1: CATATGTGTGACCTGCCGCAGACCCACTCTC
[0080] IS1 low1:
[0081] GGAAGTCACGGTGGCTGTGTTCTTTAGAACGCAGAGATTCCTGC
[0082] IS1 up2:
[0083] GGAATCTCTGCGTTCTAAAGAACACAGCCACCGTGACTTCCAGCCTGT TC
[0084] IS1 low2: GGATCCTTAGTCACCACGGTCACCACGCATACCACC
[0085] After using the PCR method to obtain these two ...
Embodiment 2
[0091] Take 1 pET-IS 1 For engineering bacteria, prepare grade 1 and grade 2 seeds, insert them into fermenters with 10% inoculum size, carry out large-scale cultivation, induce expression, and collect the bacteria (see Figure 7 ), using bacteriostasis solution (20mM Tris, 1mMgSO 4 , 50 μg / ml lysozyme) to suspend the cells, stir at room temperature for 60 min, and then use an ultrasonic cell disruptor to crush in an ice bath, and obtain inclusion bodies after centrifugation.
[0092] Use inclusion body washing solution (0.3% Triton X-100, 20mM Tris-HCl, 5mM EDTA, pH8.0) to wash it 2-3 times to ensure that it is cleaned, collect inclusion bodies after centrifugation, and use (30mM Tris- HCl, 10mM DTT, 6M guanidine hydrochloride or 8M urea) extracts were denatured and extracted at a volume of 1:20, and the supernatant was taken after centrifugation, and the refolding solution (20mM Tris-HCl, 0.3mM GSSG) was used at a volume of 1:20 80 volume for dilution and renaturation.
...
Embodiment 3
[0095] (1) Inhibition of neovascularization:
[0096] First, qualitative filter paper is used as the sample carrier, and the IS is cut into 5mm2 pieces of paper. 1 The fusion protein was diluted with normal saline, and the blank control was directly added with normal saline dropwise. The eggs were first sterilized with iodine, and then further wiped and sterilized with 75% ethanol. At the air chamber of the egg, carefully poke a small opening on the top of the egg embryo with tweezers, and then peel off the surrounding eggshell and shell membrane to make the opening about 1.5cm×1.5cm in size. Carefully use pointed surgical forceps to pierce the air cell membrane from the separation between the air cell and the yolk sac, gently remove the upper air cell membrane, and expose the underlying cAM membrane. The microcarriers were added to the part of the yolk sac membrane with fewer blood vessels, and the corresponding dose of medicament was dropped, then sealed with adhesive tape...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com