Biomarker for mass colorectal cancer screening

A biomarker, colorectal cancer technology, applied in biochemical equipment and methods, microbial determination/inspection, application, etc., can solve problems such as research on detection methods without RSPO2 gene methylation, and achieve fast processing and cost. Low, convenient and flexible sample collection effect

Active Publication Date: 2013-02-20
WENZHOU MEDICAL UNIV
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] At present, although there is a detection method for DNA gene methylation in the prior a

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biomarker for mass colorectal cancer screening
  • Biomarker for mass colorectal cancer screening
  • Biomarker for mass colorectal cancer screening

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0036] Example 1

[0037] Down-regulation of RSPO2 expression in colorectal cancer

[0038] The total RNA of cells was extracted by Trizol method and reverse transcribed into cDNA by Invitrogen's MLV-reverse transcriptase kit. The operations were performed according to the method recommended by the kit. Based on the human RSPO2 nucleotide sequence, the primers RSPO2-F and RSPO2-R are designed for fluorescent quantitative PCR. The primer sequences are as follows:

[0039] Primer RSPO2-F: 5’-ACAATACTGTGTCCAACCAT-3’;

[0040] Primer RSPO2-R: 5'-TCCTCTTCTCCTTCGCCTTT-3';

[0041] Using GADPH as the internal control, the amplification primers are:

[0042] GADPH-F: 5’- ACGGATTTGGTCGTATTGGGC -3’;

[0043] GADPH-R: 5’-CTCGCTCCTGGAAGATGGTGAT -3’.

[0044] Using cDNA as a template, the RealMssterMix kit from TIANGEN was used for real-time fluorescent quantitative PCR reaction, and the operation was carried out according to the recommended method of the kit.

[0045] Specifically, the PCR reaction s...

Example Embodiment

[0051] Example 2

[0052] Identifying RSPO2 methylation as a potential colorectal cancer biomarker

[0053] (1) The expression of RSPO2 in intestinal cancer cells was up-regulated after 5-aza-2'-deoxycytidine treatment

[0054] The low expression of RSPO2 in intestinal cancer cells may be caused by epigenetic abnormalities. In order to distinguish whether it is caused by gene methylation or histone modification, we used DNA methyltransferase inhibitor 5-aza-2'-deoxycytidine and histone deacetylase inhibitor trichostatin respectively. Intestinal cancer cells were treated with Supplement A and then the expression of RSPO2 mRNA in the cells was detected.

[0055] Specifically, 1×10 5 Cells / well were seeded in a 6-well plate and cultured for 24 h. Experiment with the following groups:

[0056] The control group was the cells that were not treated with drugs during the same period;

[0057] test group:

[0058] ① 5-Aza-dC group: 2 μM 5-Aza-dC treatment for 96 h,

[0059] ②TSA group: 0.3 μM ...

Example Embodiment

[0082] Example 3

[0083] Application of MSP to detect RSPO2 methylation status in colorectal cancer tissues

[0084] Genomic DNA extraction and sodium bisulfite modification were the same as those described in Example 2. The MSP method was used to detect the methylation status of RSPO2 in colorectal cancer tissue and normal intestinal mucosa tissue. Specifically, using the modified DNA as a template, using methylated primers, RSPO2-M1 and RSPO2-M2, and non-methylated specific primers, RSPO2-U1 and RSPO2-U2, perform PCR amplification to amplify fragments The size is 139 bp.

[0085] The PCR reaction system is 20 μl: 10×PCR buffer 2 μl, Taq enzyme 0.5 μl, 10 mM dNTP 2 μl, DNA 60 ng, 10 mM primers 1 μl each, ddH 2 Add O to 20 μl. The PCR reaction conditions were: pre-denaturation at 94°C for 3 min, 94°C for 30 s, annealing for 45 s, 72°C for 40 s, 37 cycles, and extension at 72°C for 10 min. The PCR products were detected by 2% agarose gel electrophoresis.

[0086] Using the MSP me...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention discloses a biomarker for mass colorectal cancer screening, wherein the biomarker is RSPO2 gene. The present invention further discloses a RSPO2 gene methylation MSP detection method, which comprises the following steps: extracting genome DNA containing RSPO2 gene, and detecting purity and content; carrying out treatment modification by using sodium bisulfite; adopting the modified DNA as a template, designing RSPO2 methylation specific primers, carrying out PCR amplification, and then taking the PCR product to carry out electrophoresis detection; and analyzing a result, wherein a methylation positive result exists if a 139 bp band product is amplified through the RSPO2 methylation specific primers, ie., RSPO2 methylation exists. According to the present invention, RSPO2 is adopted as a biomarker for mass colorectal cancer screening, and an RSPO2 methylation status detection method is provided, such that whether patients suffer from colorectal cancer can be detected, and characteristics of no invasion, convenient and flexible sample collection, and the like are provided.

Description

technical field [0001] The invention relates to the technical field of colorectal cancer screening, in particular to a biomarker used for a large number of colorectal cancer screenings, that is, the methylation status of the biomarker in a DNA sample is detected to determine Likelihood of colorectal cancer. Background technique [0002] Colorectal cancer is one of the most common malignant tumors of the digestive tract in the world, and its morbidity and mortality both rank third among malignant tumors and are on the rise. The incidence of colorectal cancer in North America and Western European countries reached 44.4 / 100,000 and 42.9 / 100,000 respectively, and it has reached 13.29 / 100,000 in my country. Colorectal cancer usually undergoes 7 to 10 years of evolution from normal mucosal tissue, adenoma, and then to malignant tumors. The early cure rate of colorectal cancer can reach 90%, but the late cure rate is only 5%. Therefore, early screening and surgical resection of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/12C12Q1/68
Inventor 鲁新成路立婷廖婉琴武长杰邱孙全
Owner WENZHOU MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap