Synechocystis efficient double homologous recombinant vector as well as construction method and application thereof
A homologous recombination and construction method technology, applied in the field of genetic engineering, can solve the problems of high-efficiency expression of exogenous genes and few reports, and achieve the effects of increasing content, increasing biomass, and increasing total fatty acid content
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0076] Isolation and cloning of cDNA fragments of Synechocystis delta15 fatty acid desaturase gene Delta15 and Delta6 fatty acid desaturase gene Delta6, double homologous recombination fragment psbA2 promoter, psbA2ORF cDNA fragment and Escherichia coli Terminator T1T2 cDNA fragment.
[0077] Cloning of the psbA2 promoter gene fragment of Synechocystis sp. PCC 6803:
[0078] Primers were designed according to the front-end sequence of psbA2ORF in Synechocystis sp. PCC 6803 (accession number: BA000022, AP012205) registered in GenBank, and the first 500 bp of psbA2ORF was used as the promoter sequence (sequence shown in SEQ ID NO: 1, Synchocystis sp. PCC6803), and the design PCR primers:
[0079] Promotor-F: 5'-GATGTCGACGCTTTAGCGTTCCAGTG-3',
[0080] Promotor-R: 5'-CATTTGGTTATAATTCCTT ATGTAT-3',
[0081] The amplification program was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, renaturation at 55°C for 30 s, extension at 72°C for 1 min, after...
Embodiment 2
[0109] Construction and transformation of double homologous recombination expression vector in Synechocystis sp. PCC6803
[0110] Through the overexpression technology, the Delta15 gene fragment and the Delta6 gene fragment of Synechocystis sp. PCC6803 were overexpressed in Synechocystis sp. PCC6803. According to the phenotype and fatty acid composition of the transgenic positive Synechocystis sp. Construction method and application in fatty acid synthesis.
[0111] Preparation of plasmid pBluscript SK plus-T1T2:
[0112] Plasmid pKK233-2 (purchased from Clontech Company) for amplifying the E. coli T1T2 terminator, introducing a PstI restriction site at its 5' end and a BamHI restriction site at its 3' end, the primers used are:
[0113] T1T2-F: 5'—ATACTGCAGCCAAGCTTGGCTGTTTTGGC—3';
[0114] T1T2-R: 5’—TTAGGATCCCCCATTATTGAAGCATTTAT—3’;
[0115] The amplification procedure is as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, renaturation at 60°C f...
Embodiment 3
[0123] Detection of Delta15 and Delta6 Gene Expression Levels in Transgenic Synechocystis Positive Plants
[0124] The total RNA was extracted from the transgenic Synechocystis sp. PCC6803 containing the expression vector pSDSy15, the transgenic Synechocystis sp. PCC6803 containing the expression vector pSDSy15Sy6, and the wild type Synechocystis sp. PCC6803 for Real time quantitative PCR analysis. The specific method is as follows:
[0125] Total RNA was extracted from Synechocystis and wild-type Synechocystis with Delta15 and Delta15+Delta6 genes using TRIZOL reagent (purchased from Invitrogen) and liquid nitrogen grinding. The specific operation steps are as follows: take 50ml of cyanobacteria with OD=1.8, centrifuge at 5000rpm at 4°C for 10min to collect the algae cells, grind them in liquid nitrogen to a fine powder, add them to a 1.5ml centrifuge tube, quickly add 1ml TRIZOL (purchased from Invitrogen), Invert and mix well, let stand at room temperature for 5min, centri...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 