Check patentability & draft patents in minutes with Patsnap Eureka AI!

Saccharomyces boulardii surface display system and construction method thereof

A surface display system and surface display technology, applied in the field of protein surface display systems

Inactive Publication Date: 2013-04-10
SHANDONG AGRICULTURAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As a probiotic, the surface display system of Saccharomyces boulardii has not seen any research and reports at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Saccharomyces boulardii surface display system and construction method thereof
  • Saccharomyces boulardii surface display system and construction method thereof
  • Saccharomyces boulardii surface display system and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 Design primers:

[0045] Referring to the technology of Saccharomyces cerevisiae expression display system, according to the sequence of AGA1 gene (NM_001183221 in Gene Bank), the sequence of AGA2 gene (NM_001180897 in Gene Bank), the sequence of AGA2 gene expression nucleus and the sequence of EGFP gene in Saccharomyces cerevisiae , respectively designed and synthesized a pair of specific primers for the gene, the sequences are:

[0046] AGA1-F: TTGCGGCCGCATGACATTATCTTTCGCTC, its gene sequence is shown in Seq ID No:1;

[0047] AGA1-R: GGAGATCTTTAACTGAAAATTACATTG, its gene sequence is shown in Seq ID No:2;

[0048] AGA2-F: TGGATCCATGCAGTTACTTCGCTGTT, its gene sequence is shown in Seq ID No: 3;

[0049] AGA2-R: CCCAAGCTTAAAAACATACTGTGTG, its gene sequence is shown in Seq ID No:4;

[0050] AGA2-R': TGTCGACTCAATGGTGATGGTGATGATG, its gene sequence is shown in Seq ID No:5;

[0051] EGFP-F: CCCTCGAGCCATGTCTAAAGGTGAAG, its gene sequence is shown in Seq ID No: 6; ...

Embodiment 2

[0053] The extraction of embodiment 2 yeast DNA:

[0054] Streak culture of Saccharomyces boulardii on YPD medium to obtain a single colony, randomly select a single colony to pick out, and cultivate Saccharomyces boulardii overnight with YPD medium under the growth conditions of 30°C and 225rpm According to the instructions of the Yeast Genome Extraction Kit (purchased from BIOMIGA), the genomic DNA of Saccharomyces boulardii was extracted.

Embodiment 3

[0055] The acquisition of embodiment 3 recombinant plasmid pSP+kanM:

[0056] The anti-geneticin gene kanMX and the basic plasmid pSP were subjected to NdeI / StuI double enzyme digestion (refer to the existing technology for the enzyme digestion method), the original auxotrophic URA3 gene of the basic plasmid pSP was excised, and the kanMX gene fragment and The digested product of the basic plasmid pSP was ligated at 22°C for 2h. The connection system is: 6 μl of kanMX gene fragment, 1 μl of basic plasmid pSP, 1 μl of T4DNA Ligase, 1 μl of T4Ligase buffer, and 1 μl of PEG4000. The ligated products were transformed into TOP10 competent cells, and screened with G418-resistant medium plates. Pick the transformed colonies that grow well on the culture plate, expand the LB culture medium, extract the plasmid with a plasmid extraction kit, and use NdeI / StuI enzyme double digestion to further identify the correctness of the plasmid. The restriction band should be 1455bp and 6828bp. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a protein surface display system and specifically provides a surface display system taking saccharomyces boulardii as an expression heterologous protein of the surface display system. The saccharomyces boulardii of the system is purchased from Laboratoires Biocodex in France, the registration certificate number of an imported drug is s20040038, an AGA1 gene and an AGA2 gene are obtained by amplification in a DNA (deoxyribonucleic acid) group, a pPIC9AGA2 plasmid is taken as a template for amplification of an AGA2 gene expression core, and the AGA2 gene of the saccharomyces boulardii is used for replacing the AGA2 gene in the AGA2 gene expression core. The obtained AGA1 gene and the AGA2 gene expression core after replacement are connected onto a basic plasmid pSP and respectively controlled by over-expression promoters TEF1 and PGK1, and then a general surface display expression plasmid pSDSb which can express on the surface of the saccharomyces boulardii can be further obtained. The system disclosed by the invention can continuously express the heterologous protein which is fused with Aga2p, be displayed on the surface of the saccharomyces boulardii, further realize the over-expression of the certain heterologous protein, take the heterologous protein as a pathogen live vaccine carrier, further research the interaction between the proteins and realize the actions which can not be replaced by other microorganism carriers.

Description

technical field [0001] The invention relates to a protein surface display system, and specifically provides a Saccharomyces boulardii surface display system capable of expressing and displaying heterologous proteins and a construction method thereof. Background technique [0002] Saccharomyces boulardii is a non-pathogenic yeast isolated from Indonesian litchi and other fruits by French scientist Henri Boulard in 1920. Since Ducluzeau first published the experimental results of Saccharomyces boulardii as a probiotic in 1982, there have been clinical trials on Saccharomyces boulardii anti-toxin and antidiarrheal, maintaining the micro-ecological balance of the host gastrointestinal tract, and improving the body's non-specific immunity. and more and more research. Saccharomyces boulardii is now recognized as one of the most valuable probiotics and is widely used in clinical medicine and animal husbandry production in many countries around the world. At present, Saccharomyces...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/81C12N1/19C12R1/865
Inventor 赵孝民王甜甜孙慧
Owner SHANDONG AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More