Saccharomyces boulardii surface display system and construction method thereof
A surface display system and surface display technology, applied in the field of protein surface display systems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Example 1 Design primers:
[0045] Referring to the technology of Saccharomyces cerevisiae expression display system, according to the sequence of AGA1 gene (NM_001183221 in Gene Bank), the sequence of AGA2 gene (NM_001180897 in Gene Bank), the sequence of AGA2 gene expression nucleus and the sequence of EGFP gene in Saccharomyces cerevisiae , respectively designed and synthesized a pair of specific primers for the gene, the sequences are:
[0046] AGA1-F: TTGCGGCCGCATGACATTATCTTTCGCTC, its gene sequence is shown in Seq ID No:1;
[0047] AGA1-R: GGAGATCTTTAACTGAAAATTACATTG, its gene sequence is shown in Seq ID No:2;
[0048] AGA2-F: TGGATCCATGCAGTTACTTCGCTGTT, its gene sequence is shown in Seq ID No: 3;
[0049] AGA2-R: CCCAAGCTTAAAAACATACTGTGTG, its gene sequence is shown in Seq ID No:4;
[0050] AGA2-R': TGTCGACTCAATGGTGATGGTGATGATG, its gene sequence is shown in Seq ID No:5;
[0051] EGFP-F: CCCTCGAGCCATGTCTAAAGGTGAAG, its gene sequence is shown in Seq ID No: 6; ...
Embodiment 2
[0053] The extraction of embodiment 2 yeast DNA:
[0054] Streak culture of Saccharomyces boulardii on YPD medium to obtain a single colony, randomly select a single colony to pick out, and cultivate Saccharomyces boulardii overnight with YPD medium under the growth conditions of 30°C and 225rpm According to the instructions of the Yeast Genome Extraction Kit (purchased from BIOMIGA), the genomic DNA of Saccharomyces boulardii was extracted.
Embodiment 3
[0055] The acquisition of embodiment 3 recombinant plasmid pSP+kanM:
[0056] The anti-geneticin gene kanMX and the basic plasmid pSP were subjected to NdeI / StuI double enzyme digestion (refer to the existing technology for the enzyme digestion method), the original auxotrophic URA3 gene of the basic plasmid pSP was excised, and the kanMX gene fragment and The digested product of the basic plasmid pSP was ligated at 22°C for 2h. The connection system is: 6 μl of kanMX gene fragment, 1 μl of basic plasmid pSP, 1 μl of T4DNA Ligase, 1 μl of T4Ligase buffer, and 1 μl of PEG4000. The ligated products were transformed into TOP10 competent cells, and screened with G418-resistant medium plates. Pick the transformed colonies that grow well on the culture plate, expand the LB culture medium, extract the plasmid with a plasmid extraction kit, and use NdeI / StuI enzyme double digestion to further identify the correctness of the plasmid. The restriction band should be 1455bp and 6828bp. ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
