A kind of prion protein antibody and its preparation method and application
A prion protein and antibody technology, applied in the field of prion protein antibody and its preparation, can solve the problem that the prion protein antibody cannot meet the needs of the detection market and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0096] Preparation of prion gene knockout sheep
[0097] The animals used for immunization in this example were obtained from the Shanghai Transgenic Research Center. For the detailed preparation method, see the patent "A Method for Preparing Prion Gene Knockout Livestock", application number: 200510110773.6. The passaged sheep with complete knockout of the prion protein gene were used for subsequent experiments.
Embodiment 2
[0099] Preparation of recombinant prion protein antigen for sheep immunization
[0100] 1. Cloning of sheep Prnp gene
[0101] Referring to GENBANK, the sheep prion protein gene sequence is registered, and its Genbank number is: EU253454.
[0102] According to this sequence, design PCR amplification primer, its sequence is as follows:
[0103] SEQ ID NO: 1CCCAAGCTTAAGAAGCGACCAAAAACCTGG;
[0104] SEQ ID NO: 2 CCGCTCGAGACTTGCCCCCCTTTGGTAAT.
[0105] Amplify the mature mRNA sequence of sheep PRNP (remove the N-terminal and C-terminal signal peptides), and introduce restriction sites at both ends. Since the coding region of the sheep PRNP gene is a single-exon gene, sheep genomic DNA is used as a template. KOD-Plus high-fidelity enzyme was used for amplification, and the reaction system is shown in Table 1.
[0106] Table 1
[0107] components
add volume
10×PCR buffer
2μl
dNTP mix
2μl
25mmol / L Mg2+
1.5μl
20μmol / L upstream a...
Embodiment 3
[0121] Preparation and Characteristic Analysis of Recombinant Sheep Prion Protein Polyclonal Antibody
[0122] The purified recombinant protein was immunoidentified by using Western-blot method, using prion protein monoclonal antibody SAF32 (SPI-bio) as the primary antibody, and horseradish peroxidase-labeled goat anti-mouse polyclonal antibody as the secondary antibody. resistance, see the result Figure 4 , it can be seen that the purified protein can specifically bind to the prion protein monoclonal antibody.
[0123] 1. Immunity
[0124] The recombinant prion protein prepared and purified in Example 2 was used as the immunogen, injected subcutaneously at 4-5 points on the back of the transgenic sheep for immunization, 4 consecutive immunizations with 15 days interval between each time, before immunization and 7 days after each immunization , Collect jugular vein blood, collect 20ml serum, and measure its ELISA titer.
[0125] For the first immunization, fully emulsify t...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com