Unlock instant, AI-driven research and patent intelligence for your innovation.

Sodium/potassium ion ratio detection method, system and kit

A technology of potassium ions and kits, applied in the field of biomedicine, can solve the problems of direct measurement of sodium/potassium ratio, complicated operation, large error, etc., and achieve the effect of low test cost, simple operation and high specificity

Active Publication Date: 2015-12-23
INST OF CHEM CHINESE ACAD OF SCI
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The advantage of the enzymatic method is that no special equipment is required, but the disadvantage is that it is more expensive
[0011] (5) Atomic spectrophotometry can also be used to detect potassium and sodium ions in serum, but the operation is complicated and the error is large, and it is not as simple as flame photometry
So far, there is no direct method for determining the sodium / potassium ratio

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sodium/potassium ion ratio detection method, system and kit
  • Sodium/potassium ion ratio detection method, system and kit
  • Sodium/potassium ion ratio detection method, system and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] In this embodiment, the base sequence of the DNA molecule with a fluorescent label group that can form different G-quadruplex structures in the presence of sodium and potassium ions is AGGGTTAGGGTTAGGGTTAGGG, and the fluorescent label group is 6-carboxyl Fluorescein (FAM) and 6-carboxytetramethylrhodamine (TAMRA).

[0058] 1) Prepare standard solution samples and test solutions

[0059] A certain amount of DNA was dissolved in a Tris-HCl buffer with a pH of 7.2 to prepare a DNA mother solution with a concentration of 0.7 μmol / L for use.

[0060] Take 150μL of each of the 11 DNA stock solutions above, and add 350μL of sodium / potassium ion ratio into 8 DNA solutions of 1 (100mmol / 100mmol), 2 (50mmol / 25mmol), 3 (75mmol / 25mmol), 4 (80mmol / 20mmol), 5 (100mmol / 20mmol), 6 (300mmol / 50mmol), 7 (70mmol / 10mmol), 8 (800mmol / 100mmol) solutions, get 8 standard solution samples;

[0061] Add 350 μL of urine samples to the other three DNA solutions to obtain three test solutions.

[0062] Plac...

Embodiment 2

[0070] In this embodiment, the base sequence of the DNA molecule with a fluorescent tag group that can form different G-quadruplex structures in the presence of sodium and potassium ions is TTAGGGTTAGGGTTAGGGTTAGGG, and the fluorescent tag group used is 6-Carboxyfluorescein (FAM) and 6-Carboxytetramethylrhodamine (TAMRA)

[0071] 1) Prepare standard solution samples and test solutions

[0072] A certain amount of DNA was dissolved in a boric acid-borax buffer with a pH of 8.2 to prepare a DNA mother solution with a concentration of 1.5 μmol / L for use.

[0073] Take 11 parts of the above-mentioned DNA stock solution each with 75μL, add 425μL of sodium / potassium ion ratio into 8 parts of DNA solution, respectively, 1 (50mmol / 50mmol), 2 (200mmol / 100mmol), 3 (60mmol / 20mmol), 4 (40mmol / 10mmol), 5 (100mmol / 20mmol), 6 (120mmol / 20mmol), 7 (35mmol / 5mmol), 8 (80mmol / 10mmol) solutions, get 8 standard solution samples.

[0074] Add 425 μL of saliva sample to the other 3 DNA solutions to obtain 3...

Embodiment 3

[0082] In this embodiment, the base sequence of the DNA molecule capable of forming a G quadruplex with a fluorescent labeling group is GGGCCAGGGAGCGGGGCGGAGGGGG, and the fluorescent labeling molecules used are 3H-indocyanine dye (Cy3) and 3H- Indocyanine dyes (Cy5).

[0083] 1) Prepare standard solution samples and test solutions

[0084] A certain amount of DNA is dissolved in a boric acid-borax buffer with a pH of 7.4 to prepare a DNA mother solution with a concentration of 2 μmol / L for use.

[0085] Take 300 μL of each of the 11 DNA stock solutions mentioned above, and add 200 μL of sodium / potassium ion ratios of 1, 2, 3, 4, 5, 6, 8, 10 to 8 of the DNA solutions to obtain 8 standards Solution sample.

[0086] Add 200 μL of serum samples to the other 3 DNA solutions to obtain 3 test solutions.

[0087] 2) Detection and analysis

[0088] The above samples were analyzed by fluorescence spectrometer respectively. All operations are carried out at room temperature without additional co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a sodium / potassium ion ratio detecting method, a sodium / potassium ion ratio detecting system and a sodium / potassium ion ratio detecting kit. The invention relates to a method for detecting a sodium / potassium ion ratio concentration. The method comprises the following steps: (1) preparing multiple solution samples with different sodium / potassium ion ratios; (2) putting the multiple solution samples under a fluorescence spectrophotometer, and testing fluorescence intensity values at a first wavelength and a second wavelength; (3) acquiring a standard curve of the sodium / potassium ion ratios; (4) adding DNA molecules with fluorescently-labeled groups and can form different G-four chain structures in the presence of sodium and potassium ions respectively into a liquid sample to be tested, and regulating pH value of the sample so as to obtain a test solution; (5) putting the test solution under the fluorescence spectrophotometer, and testing fluorescence intensity values at the first wavelength and the second wavelength; and (6) finding a corresponding sodium / potassium ion concentration ratio of the test solution in the standard curve of the sodium / potassium ion ratios according to a ratio of the fluorescence intensity value tested at the first wavelength to the fluorescence intensity value tested at the second wavelength in the step (5).

Description

Technical field [0001] The invention belongs to the field of biomedicine, and specifically relates to a sodium / potassium ion ratio detection method, system and kit. Background technique [0002] Sodium and potassium ions in the human body are the main cations that maintain the physiological activities of cells. They are necessary to maintain the body's normal osmotic pressure and acid-base balance, participate in the metabolism of sugar and protein, and ensure the normal function of neuromuscular. Its content is necessary for the physiological activities of the human body. Important indicators. The levels of sodium and potassium ions in urine and serum can be used clinically to diagnose some kidney, heart and other diseases. [0003] The level of sodium and potassium ions in the human body is in a balanced state, and the change of its ratio has an important impact on human health. For health, monitoring the ratio of sodium / potassium ions may be more important than the absolute va...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N21/64
Inventor 孙红霞唐亚林向俊锋杨千帆管爱娇刘岩
Owner INST OF CHEM CHINESE ACAD OF SCI