Sodium/potassium ion ratio detection method, system and kit
A technology of potassium ions and kits, applied in the field of biomedicine, can solve the problems of direct measurement of sodium/potassium ratio, complicated operation, large error, etc., and achieve the effect of low test cost, simple operation and high specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] In this embodiment, the base sequence of the DNA molecule with a fluorescent label group that can form different G-quadruplex structures in the presence of sodium and potassium ions is AGGGTTAGGGTTAGGGTTAGGG, and the fluorescent label group is 6-carboxyl Fluorescein (FAM) and 6-carboxytetramethylrhodamine (TAMRA).
[0058] 1) Prepare standard solution samples and test solutions
[0059] A certain amount of DNA was dissolved in a Tris-HCl buffer with a pH of 7.2 to prepare a DNA mother solution with a concentration of 0.7 μmol / L for use.
[0060] Take 150μL of each of the 11 DNA stock solutions above, and add 350μL of sodium / potassium ion ratio into 8 DNA solutions of 1 (100mmol / 100mmol), 2 (50mmol / 25mmol), 3 (75mmol / 25mmol), 4 (80mmol / 20mmol), 5 (100mmol / 20mmol), 6 (300mmol / 50mmol), 7 (70mmol / 10mmol), 8 (800mmol / 100mmol) solutions, get 8 standard solution samples;
[0061] Add 350 μL of urine samples to the other three DNA solutions to obtain three test solutions.
[0062] Plac...
Embodiment 2
[0070] In this embodiment, the base sequence of the DNA molecule with a fluorescent tag group that can form different G-quadruplex structures in the presence of sodium and potassium ions is TTAGGGTTAGGGTTAGGGTTAGGG, and the fluorescent tag group used is 6-Carboxyfluorescein (FAM) and 6-Carboxytetramethylrhodamine (TAMRA)
[0071] 1) Prepare standard solution samples and test solutions
[0072] A certain amount of DNA was dissolved in a boric acid-borax buffer with a pH of 8.2 to prepare a DNA mother solution with a concentration of 1.5 μmol / L for use.
[0073] Take 11 parts of the above-mentioned DNA stock solution each with 75μL, add 425μL of sodium / potassium ion ratio into 8 parts of DNA solution, respectively, 1 (50mmol / 50mmol), 2 (200mmol / 100mmol), 3 (60mmol / 20mmol), 4 (40mmol / 10mmol), 5 (100mmol / 20mmol), 6 (120mmol / 20mmol), 7 (35mmol / 5mmol), 8 (80mmol / 10mmol) solutions, get 8 standard solution samples.
[0074] Add 425 μL of saliva sample to the other 3 DNA solutions to obtain 3...
Embodiment 3
[0082] In this embodiment, the base sequence of the DNA molecule capable of forming a G quadruplex with a fluorescent labeling group is GGGCCAGGGAGCGGGGCGGAGGGGG, and the fluorescent labeling molecules used are 3H-indocyanine dye (Cy3) and 3H- Indocyanine dyes (Cy5).
[0083] 1) Prepare standard solution samples and test solutions
[0084] A certain amount of DNA is dissolved in a boric acid-borax buffer with a pH of 7.4 to prepare a DNA mother solution with a concentration of 2 μmol / L for use.
[0085] Take 300 μL of each of the 11 DNA stock solutions mentioned above, and add 200 μL of sodium / potassium ion ratios of 1, 2, 3, 4, 5, 6, 8, 10 to 8 of the DNA solutions to obtain 8 standards Solution sample.
[0086] Add 200 μL of serum samples to the other 3 DNA solutions to obtain 3 test solutions.
[0087] 2) Detection and analysis
[0088] The above samples were analyzed by fluorescence spectrometer respectively. All operations are carried out at room temperature without additional co...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 