Kit used for detecting E2A-PBX fusion gene relative expression quantity
A relative expression level and fusion gene technology, applied in the field of genetic detection kits, can solve the problems of high cost and low specificity, and achieve the effect of simple operation, low detection cost and good specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] The kit for detecting the relative expression of E2A-PBX fusion gene of the present invention comprises:
[0026] Red blood cell lysate;
[0027] TRIzol;
[0028] Chloroform;
[0030] Detection system PCR reaction solution: ReverTraAce qPCR RT Kit (TOYOBO); THNDERBIRD ProbeqPCR Mix (2×) E2A-PBX upstream and downstream primers 0.8uM, E2A-PBX probe 0.4uM; abl upstream and downstream primers 0.8uM, abl-probe (probe) 0.4uM;
[0031] Where: E2A-PBX-F: GGCAGCCACCCCCGAGGACG
[0032] E2A-PBX-R: TCTGTGGGTTCCTCCTCCTGG
[0033] E2A-PBX-Probe: FAM-CCTCCCCAGCCAGCCAGGCACCCT-TAMRA
[0034] abl-F: GCCGTGAAGACCTTGAAGGAG
[0035] abl-R: ATGATATAGAACGGGGGCTC
[0036] abl-Probe: FAM-ACCTGGTGCAGCTCCTTGGG-TAMRA.
[0037] Positive control substance: solution containing E2A-PBX genome; negative control substance: solution without E2A-PBX genome.
Embodiment 2
[0039] The using method of kit of the present invention:
[0040] (1) Extract tissue RNA from blood: Add 1ml of erythrocyte lysate to a clean 1.5ml centrifuge tube, take 0.5ml of anticoagulated blood and mix well. Let stand at room temperature for 10 minutes; centrifuge at 5000rpm for 5min, discard the supernatant, and collect the cells at the bottom; add 0.5ml red blood cell lysate again, centrifuge at 5000rpm for 5min, discard the supernatant, and collect the cells at the bottom; add 1ml TRIzol to the cells, and pipette repeatedly until sedimentation Dissolve completely, let stand at room temperature for 5 minutes; add 0.2ml chloroform, shake evenly; centrifuge at 14000rpm at 4°C for 10 minutes, absorb the supernatant layer and transfer to another new centrifuge tube; add an equal volume of isopropanol, mix well up and down, and let stand at room temperature 10min; centrifuge at 14000rpm at 4°C for 10min, discard the supernatant, add 1ml of 75% ethanol, wash the tube wall up...
Embodiment 3
[0050] Using the nucleic acid detection kit of the present invention to detect clinical specimens
[0051] Sixty cases of acute lymphoblastic leukemia (ALL) samples were taken, and genomic RNA was extracted according to the method described in Example 2, and reagents were prepared and tested.
[0052] Add 2ul of each sample to the detection system PCR reaction solution. At the same time, make a standard curve of positive, negative, blank control, and internal reference gene / target gene. A 96-well fluorescent PCR instrument can detect 38 samples at the same time, each sample has 2 repetitions, a positive control, a negative control and a blank control. The detection time is only 100 minutes.
[0053] The experimental results are compared with the results reported by the special inspection laboratory to determine the accuracy of the sample detection. Some positive results are as follows:
[0054]
[0055] Table 1 shows the comparison between the results of this experiment...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


