Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

WRKY transcription factor of cotton and application of WRKY transcription factor

A gene and sequence technology, applied to new cotton WRKY transcription factors and their coding genes and application fields, to achieve the effects of improving stress resistance to low phosphorus stress, alleviating low phosphorus stress response, and improving stress resistance

Inactive Publication Date: 2013-06-26
HUAZHONG AGRI UNIV
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, whether the overexpression of AtWRKY75 will enhance the plant's phosphorus uptake or utilization efficiency and other effects on plant development has not been reported, and there are no other plants that are highly homologous to AtWRKY75 and participate in the regulation of phosphorus utilization and developmental regulation. to report

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • WRKY transcription factor of cotton and application of WRKY transcription factor
  • WRKY transcription factor of cotton and application of WRKY transcription factor
  • WRKY transcription factor of cotton and application of WRKY transcription factor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] The isolation clone of embodiment 1GbWRKY1 gene

[0035] The applicant cloned an EST sequence (Xu, L. et al.Differential Gene Expression in Cotton Defense Response to Verticillium dahliae by SSH.Journal of Phytopathology, 2011, 159:606-615). The tBLASTx comparison of this sequence in the NCBI gene bank revealed that this sequence may be a plant-specific WRKY transcription factor. This EST sequence does not contain a complete open reading frame. We used the RACE (rapid-amplification of cDNA ends) method to perform rapid cloning of cDNA ends by PCR to obtain the complete coding sequence of this gene.

[0036] 1. Extraction of total RNA and acquisition of cDNA from young roots of Gossypium japonicus 'Hai 7124':

[0037] Total RNA was extracted from the young roots of Gossypium gossypium 'Hai 7124' (the extraction method was based on Zhu et al. An improved simple protocol for isolation of high quality RNA from Gossypium spp. suitable for cDNA library construction. Acta Ag...

Embodiment 2

[0040] Embodiment 2: Construction of cotton GbWRKY1 gene plant overexpression vector

[0041] According to the obtained SEQ ID No.1, design primers for constructing expression vectors, respectively add SacI and XbalI restriction sites and protective bases at both ends of the primers, and the primer sequences are GbWRKY1-F (5'ATGGAACCTTGTGTTGGTAATAAG') and GbWRKY1-R (GTATCAGATGAAGATGGGGTTTCAGAAGGGAGT) was amplified by PCR using the cDNA of the GbWRKY1 gene as a template. The PCR reaction conditions were: 94°C pre-denaturation for 3 minutes; 94°C for 30 sec, 58°C for 30 sec, 72°C for 1 min, 32 cycles; 72°C for 10 min, A PCR product containing the entire ORF was obtained by PCR amplification. The PCR product was double digested with restriction enzymes SacI and XbalI (purchased from NEB Company, USA) (Buffer4+BSA, 37°C for 2 hours), and then recovered by electrophoresis using a DNA recovery kit (purchased from Qiagen Company, USA). The plant expresses the binary vector pCABIA230...

Embodiment 3

[0048] Genetic transformation and screening identification of embodiment 3GbWRKY1 gene

[0049] 1. Preparation of Arabidopsis

[0050] The test material is wild-type Arabidopsis thaliana L.Columbia ecotype. After the wild-type Arabidopsis seeds have been treated with vernalization, they are sown with special nutrient soil for planting Arabidopsis (Pei Lei, Zhenjiang, Jiangsu) and placed in an artificial culture room (16 hours of light, 22 degrees) until the Arabidopsis grows to about 4 leaves. Ding seedlings to control the growth density of Arabidopsis. After Arabidopsis grows for about 6 weeks and begins to flower, it can be transformed, and the Arabidopsis is watered enough the day before transformation;

[0051] 2. Activation of Agrobacterium

[0052]Take out the glycerol tube containing the target gene GV3101 strain from the ultra-low temperature refrigerator and melt it on ice, then streak on the LB solid medium containing 25mg / L rifampicin and 50mg / L kanamycin, and cu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to isolation and cloning, functional verification and application of an identified Gb-based WRKY1 factor in Sea Island cotton. The cDNA (Complementary Deoxyribonucleic Acid) sequence of an encoding gene of the Gb-based WRKY1 factor is as shown in SEQ ID NO: 1; and the amino acid sequence of the encoding gene is as shown in SEQ ID NO: 2. The invention also discloses a function of the gene (Gb WRKY1) for promoting the expression of the phosphate transporter; and the gene has the function of promoting the efficient utilization of arabidopsis thaliana phosphorus nutrition.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a novel cotton WRKY transcription factor (GbWRKY1) and its coding gene and application. The cDNA sequence of its coding gene is shown in SEQ ID NO: 1; the amino acid sequence of its coding gene is shown in SEQ ID NO: 2. Functional verification shows that the gene can promote the expression and function of phosphorus transport proteins, and can improve the tolerance of Arabidopsis to low phosphorus nutrition deficiency. The gene GbWRKY1 cloned by the present invention can be applied to the cultivation of plants with high phosphorus utilization through genetic transformation. Background technique [0002] Phosphorus is one of the macroelements necessary for plant growth and development, and plays a very important role in the growth, development and metabolism of plants. Phosphorus is a structural component of nucleic acids and phospholipids, a substr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/84A01H5/00
Inventor 张献龙朱龙付徐理
Owner HUAZHONG AGRI UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More