WRKY transcription factor of cotton and application of WRKY transcription factor
A gene and sequence technology, applied to new cotton WRKY transcription factors and their coding genes and application fields, to achieve the effects of improving stress resistance to low phosphorus stress, alleviating low phosphorus stress response, and improving stress resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] The isolation clone of embodiment 1GbWRKY1 gene
[0035] The applicant cloned an EST sequence (Xu, L. et al.Differential Gene Expression in Cotton Defense Response to Verticillium dahliae by SSH.Journal of Phytopathology, 2011, 159:606-615). The tBLASTx comparison of this sequence in the NCBI gene bank revealed that this sequence may be a plant-specific WRKY transcription factor. This EST sequence does not contain a complete open reading frame. We used the RACE (rapid-amplification of cDNA ends) method to perform rapid cloning of cDNA ends by PCR to obtain the complete coding sequence of this gene.
[0036] 1. Extraction of total RNA and acquisition of cDNA from young roots of Gossypium japonicus 'Hai 7124':
[0037] Total RNA was extracted from the young roots of Gossypium gossypium 'Hai 7124' (the extraction method was based on Zhu et al. An improved simple protocol for isolation of high quality RNA from Gossypium spp. suitable for cDNA library construction. Acta Ag...
Embodiment 2
[0040] Embodiment 2: Construction of cotton GbWRKY1 gene plant overexpression vector
[0041] According to the obtained SEQ ID No.1, design primers for constructing expression vectors, respectively add SacI and XbalI restriction sites and protective bases at both ends of the primers, and the primer sequences are GbWRKY1-F (5'ATGGAACCTTGTGTTGGTAATAAG') and GbWRKY1-R (GTATCAGATGAAGATGGGGTTTCAGAAGGGAGT) was amplified by PCR using the cDNA of the GbWRKY1 gene as a template. The PCR reaction conditions were: 94°C pre-denaturation for 3 minutes; 94°C for 30 sec, 58°C for 30 sec, 72°C for 1 min, 32 cycles; 72°C for 10 min, A PCR product containing the entire ORF was obtained by PCR amplification. The PCR product was double digested with restriction enzymes SacI and XbalI (purchased from NEB Company, USA) (Buffer4+BSA, 37°C for 2 hours), and then recovered by electrophoresis using a DNA recovery kit (purchased from Qiagen Company, USA). The plant expresses the binary vector pCABIA230...
Embodiment 3
[0048] Genetic transformation and screening identification of embodiment 3GbWRKY1 gene
[0049] 1. Preparation of Arabidopsis
[0050] The test material is wild-type Arabidopsis thaliana L.Columbia ecotype. After the wild-type Arabidopsis seeds have been treated with vernalization, they are sown with special nutrient soil for planting Arabidopsis (Pei Lei, Zhenjiang, Jiangsu) and placed in an artificial culture room (16 hours of light, 22 degrees) until the Arabidopsis grows to about 4 leaves. Ding seedlings to control the growth density of Arabidopsis. After Arabidopsis grows for about 6 weeks and begins to flower, it can be transformed, and the Arabidopsis is watered enough the day before transformation;
[0051] 2. Activation of Agrobacterium
[0052]Take out the glycerol tube containing the target gene GV3101 strain from the ultra-low temperature refrigerator and melt it on ice, then streak on the LB solid medium containing 25mg / L rifampicin and 50mg / L kanamycin, and cu...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
