Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for fast and simple enrichment of trace quantity of animal tissue mitochondrial DNAs

An animal tissue and mitochondrial technology, applied in recombinant DNA technology, DNA preparation, etc., can solve the problems of large demand for samples, high cost, cumbersome process, etc., and achieves less initial tissue consumption, short experiment time, and equipment requirements. low effect

Inactive Publication Date: 2013-07-31
ZHEJIANG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The traditional mitochondrial DNA enrichment method mainly relies on fractional ultracentrifugation to separate the mitochondria first, and then extracts DNA from the mitochondria, which not only requires a large amount of samples but also has a cumbersome process.
At present, the most commonly used method is to use CTAB or SDS method to simultaneously extract nuclear DNA and mitochondrial DNA, and use mitochondria-specific primers to amplify the target fragment (such as animal barcode label cox1). However, proteinase K digestion is often used in the pretreatment of animal tissue samples. Time-consuming; in addition, the silica gel membrane spin column method is also a commonly used commercial method at present. The disadvantage is that the cost is too high and it is not suitable for the analysis of large-scale samples.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for fast and simple enrichment of trace quantity of animal tissue mitochondrial DNAs
  • Method for fast and simple enrichment of trace quantity of animal tissue mitochondrial DNAs
  • Method for fast and simple enrichment of trace quantity of animal tissue mitochondrial DNAs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: Analysis of animal barcode label cox1 and mitochondrial 16S rRNA gene fragments in Macrobrachium rosenbergii muscle tissue

[0027] 1. Take a small piece of Macrobrachium rosenbergii tail muscle, put it in liquid nitrogen and grind it to powder, take about 20mg tissue sample powder, add 100μL extraction buffer, and mix with a vortex oscillator for 1min;

[0028] 2. Add 200 μL of alkaline lysate to the mixture, mix by inversion for 30 sec, and ice bath for 5 min;

[0029] 3. Add 150 μL 3M potassium acetate solution to the mixture, mix by inversion for 30 sec, and ice bath for 10 min;

[0030] 4. Add 0.45 μL of 25 mg / mL RNase A (Sangon Bioengineering Co., Ltd., product number R0675) to the mixture, incubate at 37°C for 1 hr, cool to room temperature naturally, centrifuge at 12,000×g for 10 min, and transfer the supernatant to a new 1.5 mL centrifuge tube;

[0031] 5. Add an equal volume of phenol (pH8.0) to the supernatant, mix at room temperature for 5 m...

Embodiment 2

[0042] Example 2: Analysis of individual barcode tags cox1 and mitochondrial 16S rRNA gene fragments of Artemia sinensis

[0043] 1. Take 4 Artemia sinensis adults (2 females and 2 males), put them in a 1.5mL centrifuge tube, weigh (20-30mg), add 100μL of extraction buffer, and grind on ice with a micro-grinding rod until uniform , vortex mixer for 1 min;

[0044] 2. Each tube was subjected to mitochondrial DNA enrichment, fragment amplification, and sequence analysis according to steps 2 to 12 of Example 1. For the results, see Figure 2 ~ Figure 3 and SEQ ID No.3-4.

[0045] SEQ ID No.3 is the cox1 sequence of Artemia sinensis (length 709bp, primer positions are underlined):

[0046] GGTCAACAAATCATAAAGATATTGG GACTTTATACTTTATTTTTGGAG CTTGAGCAGGAATAGTAGGAACTTCTTTAAGTATACTTATTCGAGCG GAATTAGGTCAACCTGGCTCCCTAATTGGAGATGAACAGGTATATAA TGTTATTGTAACAGCTCATGCATTTATTATAATTTTTTTCATAGTTATG CCTATCCTCATTGGAGGGTTTGGTAACTGATTAGTACCTATTATACTA GGAGCTCCTGATATGGCTTTTCCCCGCTTAAACAATTTAAGATTT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for fast and simple enrichment of trace quantity of animal tissue mitochondrial DNAs. The method comprises that trace quantity of an animal sample (of which the minimum quantity is 10mg) is subjected to alkaline cracking and nuclear genome DNAs are selectively precipitated; and the precipitated nuclear genome DNAs are subjected to multiple purification processes so that fast and simple enrichment of the mitochondrial DNAs is realized. The method is simple and feasible and has short operation time, a low cost and low equipment requirements. The DNAs enriched by the method can be directly used as reliable templates for follow-up PCR amplification molecule identification. The method can be used for pre-treatment on trace quantity of animal samples in a small identification laboratory and especially is suitable for specie identification, individual analysis and paleontology research. The method is suitable for almost all of trace quantity of animal tissue comprising hard and soft animal tissue.

Description

(1) Technical field [0001] The invention relates to a method for quickly and conveniently enriching mitochondrial DNA in a small amount of animal tissue. (2) Background technology [0002] In the middle of the 20th century, with the revelation of the DNA double helix model and the cracking of biological genetic codes, biological research gradually entered the molecular level, coupled with the invention and maturity of nucleic acid sequence determination and polymerase chain reaction (PCR) technology, based on More and more attention has been paid to molecular identification methods of DNA fragment amplification and sequence analysis. Mitochondrial DNA, as a carrier of genetic information outside the nuclear genome, is favored by molecular identification scientists due to its large copy number, fast evolution rate, no homologous recombination, and stable molecular structure. It is especially suitable for species identification, individual analysis and paleontological researc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/10
Inventor 杨劲树俞炎琴杨卫军
Owner ZHEJIANG UNIV