Green fluorescent protein marked recombinant swine fever virus,?its rescue method and application

A technology of green fluorescent protein and classical swine fever virus, applied in the field of diagnosis or detection of classical swine fever virus, can solve the problems of high cost, laborious and expensive antibody labeling

Active Publication Date: 2013-08-21
HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, after 72 hours of virus culture, NIFT and NPLA often require multiple steps: cell fixation, antibody incubation, multiple washes, lasting at least 2-3 hours, usually time-consuming and laborious
In addition, the antibody is expensive and the cost of antibody labeling is high, which needs to be improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Green fluorescent protein marked recombinant swine fever virus,?its rescue method and application
  • Green fluorescent protein marked recombinant swine fever virus,?its rescue method and application
  • Green fluorescent protein marked recombinant swine fever virus,?its rescue method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Construction of green fluorescent protein-labeled recombinant swine fever virus (EGFP-CSFV)

[0032] 1.1 Construction of full-length infectious cloning plasmid pEGFP-CSFV

[0033] The full-length infectious clone pBRCISM of CSFV Shimen strain (Li C, Huang JH, Li YF, et al. Efficient and stable rescue of classical swine fever virus from cloned cDNA using an RNA polymerase II system. Arch. Virol. 2012, doi: 10.1007 / s00705-012-1548-548) was used as the basis to construct the full-length infectious cloning plasmid pEGFP-CSFV. Inserting EGFP gene into classical swine fever virus N by fusion PCR technology pro Between the 13th and 14th amino acids of , the primers used are as follows:

[0034] N pro -412eGFP-1S:CACCTCGAGATGCTATGTGG (SEQ ID No. 1);

[0035] N pro - 412eGFP-1R: CTCGCCCTTGCTCACCATGTTTGTTTTGTATAAAAGTTC (SEQ ID No. 2);

[0036] N pro - 412eGFP-2S: AACTTTTTATACAAAACAAACATGGTGAGCAAGGGCGAGGAG (SEQ ID No. 3);

[0037] N pro - 412eGFP-2R: CCCATTGGTTT...

experiment example 2E

[0045] Experimental example 2 Stability analysis experiment of EGFP gene in the genome of recombinant classical swine fever virus (EGFP-CSFV) labeled with green fluorescent protein

[0046] The F4 cells of the green fluorescent protein-labeled recombinant classical swine fever virus (EGFP-CSFV) rescued in Example 1 were subcultured to the F8 generation, and the fluorescence of EGFP was observed before passing each generation of virus to the next generation. Harvest F4, F5, F6, F7, F8 generation virus liquid, detect virus antigen with IDEXX swine fever antigen kit, extract virus RNA at the same time, use RT-PCR to detect whether the EGFP gene exists stably. The virus liquid of each generation was inoculated into PK-15 cells cultured in a 96-well culture plate. After 48 hours, the specific fluorescence of EGFP was observed first, and then the cells were fixed with cold absolute ethanol. Mouse secondary antibody was used for IFA detection.

[0047] Cells infected with EGFP-CSFV ...

experiment example 3

[0048] Experimental example 3 One-step growth curve determination of green fluorescent protein-labeled recombinant classical swine fever virus (EGFP-CSFV)

[0049] Inoculate PK-15 cells grown to a monolayer with the green fluorescent protein-labeled recombinant swine fever virus EGFP-CSFV rescued in Example 1 and the parental virus wt-CSFV at a multiplicity of infection (MOI) of 1, and inoculate for 2 hours. After washing with PBS, maintenance solution was added and cultured at 37°C. The virus was harvested at 24, 36, 48, 60 and 72 hours after infection, and the virus solution was serially diluted 10 times, and inoculated on PK-15 cells growing to a single layer, and 2% maintenance solution was changed after 2 hours of infection, and directly after 48 hours. Observe the fluorescence of EGFP, then detect it with IFA, and calculate its TCID by Reed-Muench method 50 , to draw the virus growth curve.

[0050] Assay results show that the EGFP-CSFV rescued by Example 1 has similar...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a green fluorescent protein marked recombinant swine fever virus, its rescue method and application.?According to the invention, green fluorescent protein encoding gene is inserted between the 13th and the 14th amino acid of a classical swine fever virus infectious clone Npro protein coding region. By transfection into PK-15 cells and passage, the visual green fluorescent protein marked recombinant swine fever virus is rescued. The growth characteristics of the recombinant swine fever virus are same as that of its parental virus. After infection of PK-15 cells, the virus is directly visible by the use of fluorescence microscope. According to the modified neutralization test method (EGFP-NT) established by the recombinant swine fever virus, the existence of classical swine fever virus can be observed and the titer of neutralizing antibody in serum to be tested can be determined directly by the use of fluorescence microscope with no additional immunofluorescence test step. The method has the same specificity and sensitivity as the traditional neutralization immunofluorescence assay, but is more convenient and efficient, and can replace the neutralization immunofluorescence assay method for the use of serological test and epidemiological investigation of swine fever.

Description

technical field [0001] The present invention relates to a recombinant swine fever virus, in particular to a green fluorescent protein-labeled recombinant swine fever virus and a rescue method thereof. The present invention further relates to the use of the green fluorescent protein-labeled recombinant swine fever virus in diagnosing swine fever or quantitatively detecting serum swine fever neutralizing antibodies The application in potency belongs to the field of diagnosis or detection of classical swine fever virus. Background technique [0002] Classical swine fever (CSF) is a highly contagious disease of pigs caused by classical swine fever virus (CSFV), characterized by high fever and hemorrhage. The prevalence of swine fever can spread worldwide. cause significant economic losses. CSFV and bovine viral diarrhea virus (bovine viral diarrhea virus 1, BVDV-1), BVDV-2, border disease virus (border disease virus, BDV) belong to members of the genus Pestivirus in the family ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N7/01G01N33/569C12R1/93
Inventor仇华吉李永锋孙元李素罗玉子
OwnerHARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI