Check patentability & draft patents in minutes with Patsnap Eureka AI!

Protein for regulating and controlling chloroplast growth and gene and application thereof

A protein and chloroplast technology, applied in the field of genetic engineering

Inactive Publication Date: 2013-09-11
CHINA NAT RICE RES INST
View PDF0 Cites 20 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the research on its function has not been reported in rice

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein for regulating and controlling chloroplast growth and gene and application thereof
  • Protein for regulating and controlling chloroplast growth and gene and application thereof
  • Protein for regulating and controlling chloroplast growth and gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: Cloning of the WLP1 gene

[0036] a) Rice material

[0037] Rice (Oryza sativa L) mutant wlp1 (white leaf and panicle 1), the original wild-type material is the japonica rice variety Asominori.

[0038] b) Electron microscope observation

[0039] Using transmission electron microscopy (TEM) to observe the chloroplast ultrastructure of the third leaf of wild type and wlp1 at 23 °C, it was found that the wild type chloroplast contained normal lamella structure, while wlp1 contained less cysts similar to the plastid structure Vesicular chloroplasts, the observation of young panicle chloroplasts at the heading stage found that the mutants had less lamellar accumulation than the wild type ( image 3 ).

[0040] c) Genetic analysis and mapping populations

[0041] wlp1 was determined to be a recessive mutant by reciprocal hybridization, and the mutant was selected for hybridization with NanJing 11, the F1 generation was self-crossed, and a single plant was harv...

Embodiment 2

[0070] Embodiment 2: transgenic experiment

[0071] 1) Vector construction

[0072] Design a pair of primers that completely cover the entire WLP1 gene ORF, and design restriction sites BamHI and Sal1 on the primers, PCR amplifies the wild-type genomic DNA, electrophoresis detection gel recovery, and the recovered product is digested with BamHI and Sal1 , connected to the pCAMBIA2300 vector that was digested with the same restriction enzymes, and sequenced to confirm that no base mutation occurred. The constructed vector structure diagram is pCAMBIA-WLP1( Figure 4 ), the constructed vector was transformed into Agrobacterium tumefaciens strains by electric shock method.

[0073] The primer sequence for amplifying the ORF sequence is:

[0074] SJg-BamHI:5'-TTTGGATCCCAAGCCAGACGGACAAGAC-3' (SEQ ID NO.10)

[0075] SJg-SalI: 5'-TTTGTCGACTGAGATTGTTGTGTCTTTCTTAGTC-3' (SEQ ID NO.11)

[0076] 2) Genetic transformation:

[0077] (1) Selection of transformed receptors

[0078] The ...

Embodiment 3

[0082] Example 3: Chloroplast subcellular localization experiment of WLP1 (SEQ ID NO.2)

[0083] According to the full-length CDS sequence (SEQ ID NO.3) of WLP1, a restriction recognition site containing BamHI was designed, and recombinant primers were designed. The sequence is:

[0084] SJGFP-F: CGGTCCCGGGGGATCCATGGCTACGGCCATCGC (SEQ ID NO. 12)

[0085] SJGFP-R: TGCTCACCATGGATCCCTTCTCAGACTTCTGTATTCTTTTA (SEQ ID NO. 13)

[0086] Using the wild-type cDNA as a template, the CDS sequence (SEQ ID NO.3) of the WLP1 gene was amplified with PrimeSTAR high-fidelity enzyme. After the sequence of the amplified product was verified to be correct, it was ligated with the PAN580-GFP vector to obtain the fusion expression vector 35S ::WLP1::GFP. The plasmids of the fusion expression vector 35S::WLP1:GFP and the 35S::GFP control plasmid without gene fusion were extracted and introduced into rice protoplast cells by PEG-mediated method. The introduced rice protoplast cells were cultured in h...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a protein for regulating and controlling chloroplast growth and gene and application thereof, and belongs to the field of gene engineering technology. The invention discloses a gene nucleotide sequence for coding chloroplast growth protein and amino acid sequence of the protein. The invention provides a transgenic cell line containing the gene and transgenic recombinant bacteria containing the gene, and provides the application of the gene. The mutation of gene for coding the chloroplast growth protein can lead to low temperature albinism of young leaf and young ear albinism, and if the gene is knocked out, chloroplast development is stopped and the plant is dead at the seedling stage because of albinism. The product can be applied to the genetic improvement of plant and other works, and the gene provided is an important indication gene, and can be used as a target gene and applied to hybrid rice seed production, and is convenient for detecting purity of hybrid progeny. The product is applied in routine seed production, and because of the homozygous lethal characteristic, the product can prevent invalid seed preservation and seed product of progeny, thereby effectively protecting intellectual property of variety owner.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a protein for regulating chloroplast development and its gene and application. Background technique [0002] Leaf is the main organ of plants for photosynthesis. More than 2 / 3 of the dry matter in rice grains is obtained through photosynthesis after flowering. The efficiency of photosynthesis is related to the integrity of chloroplast structure and function, the stability of photosynthetic complex, and The level of content has a complex relationship. In recent years, the application value of leaf color has attracted much attention. Leaf color variation can be used as a marker trait, which plays an important role in rice hybrid breeding and improved rice breeding. Can be used to determine the purity of seeds. In addition, the study of leaf color mutants has important theoretical significance and application value for the effective use of genetic engineeri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N5/10C12N1/15C12N1/19C12N1/21A01H5/00
Inventor 胡培松魏祥进宋建唐绍清邵高能谢黎虹焦桂爱圣忠华陈代波
Owner CHINA NAT RICE RES INST
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More