Unlock instant, AI-driven research and patent intelligence for your innovation.

Serratia marcescens anchorin duplicon and use thereof

A technology of Serratia marcescens and ankyrin, applied in the field of genetic engineering

Active Publication Date: 2013-10-02
ANHUI UNIVERSITY OF TECHNOLOGY AND SCIENCE
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no related research on the ankyrin repeat of Serratia marcescens

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Serratia marcescens anchorin duplicon and use thereof
  • Serratia marcescens anchorin duplicon and use thereof
  • Serratia marcescens anchorin duplicon and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Preparation of Serratia marcescens ankyrin repeat

[0027] Take out the Serratia marcescens PL-06 preserved in the refrigerator at 4°C, pick a single clone and inoculate it into LB liquid medium, culture it overnight at 37°C, 200r / min for 10-12 hours, observe under microscope and identify 16SrDNA, confirm The homology with the 16SrDNA of various Serratia marcescens published in GenBank is 99%, thus confirming that the strain is Serratia marcescens, the microscopic picture is as follows Figure 5 , the 16SrDNA sequence is as sequence 1 in the sequence listing, genbank accession number: JX138534.

[0028] According to the published Serratia marcescens ankyrin repeat subsequence (GenBank: AY091641.1) of the complete genome sequence, the upstream primer SF and the downstream primer SR were designed as reference:

[0029] Upstream primer SF: 5'- CATGCCATGGTA CCTGAAGGGCGTCGCTT -3'

[0030] Downstream primer SR: 5'- CCCCTCGAGA CTGCTGCGCGTAGTG -3'.

[0031] ...

Embodiment 2

[0044] The construction of embodiment 2 recombinant bacterial strain plaS-pET-28 / BL21 and its thalline growth situation

[0045] ① The product amplified in Example 1 Pla Gel recovery with restriction endonuclease Nco I. xho I double enzyme digestion of the above recovered product and pET-28a (+) plasmid vector, the enzyme digestion system is as follows:

[0046] DNA 10μL

[0047] Nco I 1 μL

[0048] xho I 1 μL

[0049] Buffer K 5μL

[0050] Sterilized double distilled water 33μL

[0051] Total volume 50 μL.

[0052] After mixing, incubate at 37°C for 2 hours. After the end, add 10 μL 6×Loading Buffer to each 50 μL reaction solution to terminate the reaction, recover the digested fragments (about 0.7 kb and 5.4 kb), and connect the two fragments with T4 DNA ligase. The reaction system is as follows:

[0053] PCR double digestion product 12μL

[0054] pET-28a (+) double digestion product 8μL

[0055] Ligase 2μL

[0056] 10×Ligase Buffer 5μL

[0057] Sterilize...

Embodiment 3

[0062] Embodiment 3 Construction of recombinant bacterial strains plaA-pET-28 / BL21 and plaA-plaS-pET-28 / BL21 and their cell growth

[0063] ① Using the above-mentioned Serratia marcescens PL-06 genome as a template, PCR amplification was performed to obtain the phospholipase A1 gene plaA (see sequence 4 in the sequence listing) and phospholipase A1 gene + ankyrin repeat subgene i.e. plaA-plaS (See Sequence 5 in the Sequence Listing), wherein the underlined part in Sequence 4 is plaA sequence and Pla The part of sequence cross-common, the part underlined in sequence 5 is Pla sequence;

[0064] Among them, PCR amplification plaA Primers when:

[0065] Upstream primer AF: CATGCCATGGGCAGTATGCCTTTAAGT,

[0066] Downstream primer AR: CCCCTCGAGAGGCATTGGCCTTCGCCTC.

[0067] The amplification conditions are as follows:

[0068] AF 1μL

[0069] AR 1 μL

[0070] 10× PCR Buffer 5μL

[0071] 10mmol / L dNTP 2μL

[0072] 25mmol / L MgCl 2 4μL

[0073] Taq DNA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a serratia marcescens anchorin duplicon and its use in host bacteria. The serratia marcescens anchorin duplicon has a sequence shown in the formula of SEQ ID NO: 2. The invention also provides an inhibition effect of the serratia marcescens anchorin duplicon in host bacteria. The invention also provides a use of the serratia marcescens anchorin duplicon in promotion of expression of phospholipase A1 in escherichia coli. The invention also provides a recombinant vector and a recombinant strain containing the serratia marcescens anchorin duplicon. An experiment proves that through the expression of the serratia marcescens anchorin duplicon, host bacteria can be inhibited obviously. The serratia marcescens anchorin duplicon can greatly promote high-activity expression of the phospholipase A1 in escherichia coli.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a Serratia marcescens anchor protein repeat. Background technique [0002] Ankyrin was first discovered in various eukaryotes and is a widespread receptor protein. A typical ankyrin consists of four parts: a binding domain composed of ankyrin repeats, a hidden protein binding domain, and a lethal domain and C-terminal domain. Studies have shown that ankyrin repeats exist widely in various cells and tissues, and it is generally believed that ankyrin repeats are involved in protein-protein interactions. There are also a large number of ankyrin repeats in prokaryotic cells, which participate in various intramolecular and intermolecular interactions. In some pathogenic bacteria such as Legionella pneumophila and Rickettsia, ankyrin repeats are also involved in the interaction of effector proteins. secretion. Such ankyrin repeats also exist in Serratia marce...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/24C12N15/31C12N15/70C12N1/21C12R1/19C12R1/43
Inventor 薛正莲苏燕南王洲马琦亚张爽陈环
Owner ANHUI UNIVERSITY OF TECHNOLOGY AND SCIENCE