Vetiver aquaporin gene VzPIP2-1 and plant expression carrier and applications thereof
A plant expression vector, aquaporin technology, applied in the field of vetiver aquaporin gene VzPIP2-1 and its plant expression vector, to achieve the effect of increasing transpiration rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1 Cloning of Vetiver VzPIP2-1 gene
[0030] 1. Extract total RNA from vetiver: ① Take a small amount of vetiver leaves and grind in liquid nitrogen, add Trizol to the tissue sample at 50-100mg / ml Trizol, and place at room temperature for 5 minutes to fully lyse. ②Add chloroform with 200 μl chloroform / ml Trizol, shake and mix for 15 minutes, and leave at room temperature for 15 minutes. ③ Centrifuge at 12000g for 15min at 4℃. ④ Suck the upper aqueous phase into another centrifuge tube. ⑤ Add isopropanol to 0.5ml isopropanol / ml Trizol and mix well, leave at room temperature for 5-10min. ⑥ Centrifuge at 12000g at 4°C for 10min, discard the supernatant, and the RNA sinks to the bottom of the tube. ⑦ Add 75% ethanol according to 1ml 75% ethanol / ml Trizol, gently shake the centrifuge tube, and suspend the pellet. ⑧ Centrifuge at 8000g at 4°C for 5 min, and discard the supernatant as much as possible. ⑨ Air dry at room temperature or vacuum dry for 5-10 minutes, t...
Embodiment 2
[0081] Example 2 Construction of VzPIP2-1 plant expression vector
[0082] 1. Add KpnI and SpeI restriction enzyme cleavage site sequences to the 5' and 3' ends of VzPIP2-1 respectively, design and synthesize the primer VzPIP2-1-S-KpnI (GGGGTACCCATGGGCAAGGACGACGTGA) according to the primer design software Primer premier5 , SEQ ID NO. 11), primer VzPIP2-1-A-SpeI (GGACTAGTGGCGTTTGCTCCGGAAGGG, SEQ ID NO. 12) primer.
[0083] 2. Using the vetiver cDNA as the template, the primers VzPIP2-1-S-KpnI and VzPIP2-1-A-SpeI were used to amplify polymerase chain reaction (PCR, the annealing temperature of the cycle was 60 ℃) with the corresponding The target band at the restriction site was recovered and ligated to pEasy Blunt Simple Vector.
[0084] 3. Transform the ligation vector into Escherichia coli Trans1-T 1 strains. Positive clones were detected, sequenced, and the target plasmid was extracted.
[0085] 4. The target plasmid was digested with KpnI and SpeI, electrophoresis, and ...
Embodiment 3
[0087] Example 3 Transfection of Agrobacterium with plasmid pCAM1300-VzPIP2-1
[0088] 1. Pick a single colony of Agrobacterium GV3101 in 2ml of YEP medium (containing Rif 20mg / ml) for overnight activation at 28°C;
[0089] 2. Inoculate 2ml overnight bacterial solution in 50ml YEP medium and grow to OD at 28°C 600 is approximately equal to about 0.5;
[0090] 3. Centrifuge at 5000rpm for 5 minutes;
[0091] 4. Suspend cells in 10ml of 0.15M NaCl;
[0092] 5. Centrifuge at 5000rpm for 5min, and resuspend the cells in 20ml of ice-cold CaCl 2 ;
[0093] 6. Add 1 μl of plasmid pCambi1300-VzPIP2-1 to 200 μl of competent cells, and place on ice for 30 minutes;
[0094] 7. Freeze in liquid nitrogen for 1min;
[0095] 8. Thaw the cells in a 37°C water bath;
[0096] 9. Add 1ml of YEP medium and incubate at 28℃ for 2-4h;
[0097] 10. Centrifuge for 1 min, and resuspend the cells in 100 μl YEP medium;
[0098] 11. Coat the plate and incubate at 28°C for 2-3 days.
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More