Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of recombinant porcine interferon beta 1-fc fusion protein and its coding gene and expression method

A fusion protein, porcine interferon technology, applied in chemical instruments and methods, microorganism-based methods, biochemical equipment and methods, etc., can solve the problems of reducing the specific activity rate, insolubility, inactivity of recombinant proteins, etc. effect and avoid repeated drug use, control the preparation cost, and prolong the half-life

Active Publication Date: 2016-03-16
GENSUN INST OF BIOMEDICINE
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, most recombinant proteins expressed by E. coli are insoluble, inactive intracellular aggregates known as inclusion bodies
The renaturation of inclusion bodies is a very complicated process. If the renaturation conditions are not suitable, there will be mismatching of disulfide bonds in the molecule, and covalent or hydrophobic bonds between molecules will form aggregates. On the one hand, the specific activity of the recombinant protein will be reduced. rate, resulting in unqualified product quality, and at the same time, precipitation occurs, which affects the yield

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of recombinant porcine interferon beta 1-fc fusion protein and its coding gene and expression method
  • A kind of recombinant porcine interferon beta 1-fc fusion protein and its coding gene and expression method
  • A kind of recombinant porcine interferon beta 1-fc fusion protein and its coding gene and expression method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Embodiment 1 Recombinant porcine interferon beta 1-Fc fusion protein gene optimization design

[0067]According to the cDNA sequence (GenBank accession number: NM_001003923.1) of porcine interferon β1 (Susscrofainterferon, beta1) and the cDNA sequence (GenBank accession number: NM_213828.1) of porcine IgG Fc fragment (SusscrofaIgGheavychain) published by GenBank, the inventor , CH2 region and CH3 region, these two genes are directly fused and codon optimized to obtain the gene of the recombinant porcine interferon β1-Fc fusion protein of the present invention, as shown in SEQ ID No: 1.

[0068] The following is the codon optimization of the recombinant porcine interferon β1-Fc fusion protein. The parameters before and after optimization are compared as follows:

[0069] 1. Codon Adaptation Index (CAI)

[0070] Depend on Figure 2-a It can be seen that before the codon optimization, the codon adaptation index (CAI) of the recombinant porcine interferon β1-Fc fusion p...

Embodiment 2

[0081] Embodiment 2: the expression plasmid construction of recombinant porcine interferon beta 1-Fc fusion protein gene

[0082] The fragment synthesized from the optimized recombinant porcine interferon β1-Fc fusion protein gene (as shown in SEQ ID No: 1) was constructed into the pUC57 plasmid (provided by Nanjing GenScript Co., Ltd.) to obtain a long-term preservation plasmid , denoted as pUC57-pIFNβ1-Fc plasmid. Using the pUC57-pIFNβ1-Fc plasmid as a template, NdeI and XhoI restriction sites were introduced upstream and downstream, respectively, for PCR amplification. The primer sequences used are as follows:

[0083] Upstream primers:

[0084] P1: CGGGAATTCCATATGATGTCCTATGATGTTCTGCG

[0085] Downstream primers:

[0086] P2: CCGCTCGAGTTATTTGCCTTGGGTCTTGC

[0087] The total volume of the reaction was 50 μL, in which 2.5 μL was added to each primer with a concentration of 10 μmol / L, 1 μL was added to dNTP with a concentration of 10 mmol / L, and 0.5 μL was added to the D...

Embodiment 3

[0089] Example 3 High Expression and Identification of Recombinant Porcine Interferon β1-Fc Fusion Protein in Escherichia coli

[0090] Specific steps are as follows:

[0091] 1. Transform the pET21b-pIFNβ1-Fc plasmid with correct sequencing alignment in Example 2 into Escherichia coli BL21 (DE3) competent strain (purchased from Beijing Tiangen Biochemical Technology Co., Ltd.), at 37°C, in the presence of ampicillin Plate overnight.

[0092] 2. On the next day, pick 1-4 recombinant colonies containing the pET21b-pIFNβ1-Fc plasmid, insert them into LB medium containing 100 μg / mL ampicillin (purchased from Amresco), and culture overnight at 37°C.

[0093] 3. Take 50 μL of the overnight culture in step 2, add 5 mL of LB culture solution containing 100 μg / mL ampicillin, and culture with shaking at 37°C.

[0094] 4. Measure the OD of the bacterial solution every 1 hour after inoculation 600 value, to be OD 600 When =1.0, the expression was induced with 1 mmol / L IPTG (purchas...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a recombinant porcine interferon IFN beta1-Fc fusion protein as well as an encoding gene and expression, purification and inclusion body renaturation methods thereof, belonging to the biological genetic engineering field. The IFNbeta can enhance the immunity of pig and has a good application prospect in the veterinary medicine industry. However, natural porcine IFNbeta1 is less in expression quantity and is insufficient for research and development and application and has the deficiency of quick plasma clearance rate. The invention provides the recombinant porcine interferon IFN beta1-Fc fusion protein applicable to a coliform bacteria prokaryotic expression system. Part of the porcine IFNbeta1 is all sequences in an ectoenzyme area of the porcine IFNbeta1. The Fc section comprises a hinge region, a CH2 region and a CH3 region of an antibody. The porcine IFNbeta1 and the Fc section are directly fused. The fusion protein provided by the invention not only maintains the biological activity of the original protein IFNbeta1 to a great extent, but also extremely prolongs the half-life period of the original protein IFNbeta1, thereby providing the opportunity of industrialized development of the fusion protein.

Description

technical field [0001] The invention belongs to the field of bioengineering genes, and relates to a recombinant porcine interferon beta 1-Fc fusion protein and its coding gene, as well as its expression, purification and inclusion body renaturation methods. Background technique [0002] Interferon (Interferon, IFN) is a group of active proteins (mainly glycoproteins) with multiple functions, and is a cytokine produced by monocytes and lymphocytes. They have broad-spectrum anti-virus, affect cell growth, differentiation, regulation of immune function and other biological activities on the same kind of cells. According to the source of IFN, that is, animal species, cell type, the nature of the inducer and the induction conditions, it can be divided into three types: α, β, and γ. Among them, interferon-β is mainly produced by fibroblasts, which can enhance the expression of HLA1 and class II antigens on the cell surface in vivo, and increase serum levels of new butterfly and β...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K19/00C07K1/14C12N15/62C12N15/70C12N1/21C12P21/02C12R1/19
Inventor 马永王安良章成昌徐春林陈晨王耀方
Owner GENSUN INST OF BIOMEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com