Enhanced bombyx mori nuclear polyhedrosis virus inducible promoter En39k and application thereof

A karyotype polyhedron and enhanced technology, applied in the field of bioengineering, can solve problems such as limited activation activity, and achieve the effects of eliminating disease spread, good application prospect, and inducing activation activation improvement.

Active Publication Date: 2015-06-17
SOUTHWEST UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The promoter has BmNPV-inducible promoter activity, which can enable cells to start the expression of foreign genes when they are infected by BmNPV, but its promoter activity is limited, which can no longer meet the actual needs, and a more efficient BmNPV-inducible promoter is urgently needed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Enhanced bombyx mori nuclear polyhedrosis virus inducible promoter En39k and application thereof
  • Enhanced bombyx mori nuclear polyhedrosis virus inducible promoter En39k and application thereof
  • Enhanced bombyx mori nuclear polyhedrosis virus inducible promoter En39k and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1, Construction of the En39k promoter and the Luc reporter gene recombinant vector driven by it and the detection of the induction and activation activity of the En39k promoter

[0029] 1. Construction of En39k promoter and luc reporter gene recombination vector driven by it

[0030] Download the BmNPV whole genome sequence (NC001962.1) from the National Center for Biotechnology Information (NCBI), according to the cascade regulation characteristics of baculovirus, the delayed early gene promoter (β gene) is controlled by the immediate early gene (α gene) product To activate the regulatory function, the optimal sequence 39kBase of the promoter of the delayed early gene 39k of BmNPV was selected as the "maternal" promoter sequence. At the same time, the BmNPV-derived hr3 sequence and PU (polh-up) sequence were selected as enhancing elements, and the "maternal" promoter was connected in series to construct an enhanced BmNPV-inducible promoter En39k ( figure 1 , S...

Embodiment 2

[0056] Example 2, Construction of DsRed reporter gene recombinant vector driven by En39k promoter and detection of DsRed gene expression activity

[0057] 1. Construction of DsRed reporter gene recombinant vector driven by En39k promoter

[0058] Design specific primers according to the DsRed gene sequence, PCR amplify the DsRed fragment (SEQ ID No.10) with HindIII and XbaI restriction sites at both ends, and connect the DNA fragment to the pMD19-T plasmid through T cloning to construct a recombinant vector pMD19-T-DsRed, and then digest it with HindIII and XbaI, and connect it with the recombinant vectors pGL3-39kBase-luc and pGL3-En39k-luc, which were also digested with HindIII and XbaI, respectively, and replace the recombinant vector with DsRed gene luc gene in the recombinant vector pGL3-39kBase-DsRed and pGL3-En39k-DsRed ( Figure 5 ). In addition, the strong constitutive promoter A4 was used to replace the 39kBase promoter in the recombinant vector pGL3-39kBase-DsRed ...

Embodiment 3

[0063] Example 3, Construction of BmNPV Proliferation Essential Gene lef-1shRNA Vector Driven by En39k Promoter and Detection of RNA Interference Effect

[0064] 1. Construction of BmNPV lef-1 gene shRNA vector driven by En39k promoter

[0065] The following primers were designed according to the En39k promoter sequence:

[0066] Upstream primer En39k-F: TCG TCATGA ATGATTCATACTTAATCGTGCGT (SEQ ID No.11), the underlined part is the BspHI restriction site;

[0067] Downstream primer En39k-R: CCC AAGCTT GTTTGATTTTTGTAAACCTTTGA (SEQ ID No. 12), the underlined part is the HindIII restriction site.

[0068] Using the recombinant vector PGL3-En39k-luc as a template, the En39k sequence was amplified by PCR, digested with BspHI and HindIII, and then ligated with the vector PIZ / V5-His, which was also digested with BspHI and HindIII, to obtain the recombinant vector PIZ / V5 -En39k-His.

[0069] According to the BmNPV lef-1 gene sequence (GeneID: 1488636) and shRNA design principles p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses enhanced bombyx mori nuclear polyhedrosis virus (BmNPV) inducible promoter En39k and an application thereof. According to the invention, the optimal sequence of a promoter for delaying the early gene 39k through BmNPV is used as a parent promoter, then the parent promoter is serially connected with a BmNPV-sourced hr3 sequence and a PU sequence serving as enhancing elements so as to obtain the promoter which is a recombinant promoter (SEQ ID NO.1). The promoter has strong BmNPV inducible promotion activity (which is about 155 times the activity of the BmNPV39k inducible promoter in ZL201010231957.9), an exogenous gene can be driven to be efficiently expressed in an insect cell or in a single insect body after being infected with BmNPV or induced by relevant factors, the promoter is not only applicable to equimolecular biology theoretical study such as the gene function analysis, but also suitable for improvement of the silkworm variety by utilizing the gene engineering technology and especially suitable for breeding of the high-efficiency BmNPV-resisting variety of silkworm and breeding of the silkworm variety capable of eliminating the disease spreading through the expression of exogenous lethal gene or marker gene.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a virus-inducible promoter and its application. Background technique [0002] The silkworm is a Lepidoptera insect with important economic value. The silk industry has made important contributions to the world's economic, cultural and social development. Bombyx mori nuclear polyhedrosis virus (BmNPV) is the most common and most harmful pathogen in sericulture production. Its genome is a covalently closed circular double-stranded DNA with a genome of about 130kb. The 39k gene of the virus is a non-essential gene for virus replication. In the previous research work, the inventor's research group invented the BmNPV39k inducible promoter (ZL201010231957.9). The promoter has BmNPV-inducible promoter activity, which can enable cells to start the expression of foreign genes when infected by BmNPV, but its promoter activity is limited, which can no longer meet the a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/85C12N1/21A01K67/04C12R1/19
Inventor 潘敏慧鲁成匡秀秀曹明亚张军何倩
Owner SOUTHWEST UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products