Enhanced bombyx mori nuclear polyhedrosis virus inducible promoter En39k and application thereof
A karyotype polyhedron and enhanced technology, applied in the field of bioengineering, can solve problems such as limited activation activity, and achieve the effects of eliminating disease spread, good application prospect, and inducing activation activation improvement.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1, Construction of the En39k promoter and the Luc reporter gene recombinant vector driven by it and the detection of the induction and activation activity of the En39k promoter
[0029] 1. Construction of En39k promoter and luc reporter gene recombination vector driven by it
[0030] Download the BmNPV whole genome sequence (NC001962.1) from the National Center for Biotechnology Information (NCBI), according to the cascade regulation characteristics of baculovirus, the delayed early gene promoter (β gene) is controlled by the immediate early gene (α gene) product To activate the regulatory function, the optimal sequence 39kBase of the promoter of the delayed early gene 39k of BmNPV was selected as the "maternal" promoter sequence. At the same time, the BmNPV-derived hr3 sequence and PU (polh-up) sequence were selected as enhancing elements, and the "maternal" promoter was connected in series to construct an enhanced BmNPV-inducible promoter En39k ( figure 1 , S...
Embodiment 2
[0056] Example 2, Construction of DsRed reporter gene recombinant vector driven by En39k promoter and detection of DsRed gene expression activity
[0057] 1. Construction of DsRed reporter gene recombinant vector driven by En39k promoter
[0058] Design specific primers according to the DsRed gene sequence, PCR amplify the DsRed fragment (SEQ ID No.10) with HindIII and XbaI restriction sites at both ends, and connect the DNA fragment to the pMD19-T plasmid through T cloning to construct a recombinant vector pMD19-T-DsRed, and then digest it with HindIII and XbaI, and connect it with the recombinant vectors pGL3-39kBase-luc and pGL3-En39k-luc, which were also digested with HindIII and XbaI, respectively, and replace the recombinant vector with DsRed gene luc gene in the recombinant vector pGL3-39kBase-DsRed and pGL3-En39k-DsRed ( Figure 5 ). In addition, the strong constitutive promoter A4 was used to replace the 39kBase promoter in the recombinant vector pGL3-39kBase-DsRed ...
Embodiment 3
[0063] Example 3, Construction of BmNPV Proliferation Essential Gene lef-1shRNA Vector Driven by En39k Promoter and Detection of RNA Interference Effect
[0064] 1. Construction of BmNPV lef-1 gene shRNA vector driven by En39k promoter
[0065] The following primers were designed according to the En39k promoter sequence:
[0066] Upstream primer En39k-F: TCG TCATGA ATGATTCATACTTAATCGTGCGT (SEQ ID No.11), the underlined part is the BspHI restriction site;
[0067] Downstream primer En39k-R: CCC AAGCTT GTTTGATTTTTGTAAACCTTTGA (SEQ ID No. 12), the underlined part is the HindIII restriction site.
[0068] Using the recombinant vector PGL3-En39k-luc as a template, the En39k sequence was amplified by PCR, digested with BspHI and HindIII, and then ligated with the vector PIZ / V5-His, which was also digested with BspHI and HindIII, to obtain the recombinant vector PIZ / V5 -En39k-His.
[0069] According to the BmNPV lef-1 gene sequence (GeneID: 1488636) and shRNA design principles p...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
