Unlock instant, AI-driven research and patent intelligence for your innovation.

Soy nuclear factor protein GmNFYB and coding gene and application thereof

A technology encoding genes and proteins, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problem of little research on NFYB transcription factors related information, and achieve the effect of increasing root length and increasing seed germination rate.

Inactive Publication Date: 2014-04-09
NORTHEAST AGRICULTURAL UNIVERSITY
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, compared with other plants such as Arabidopsis, rice, maize, and wheat, there is little research on NFYB transcription factors in soybean.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Soy nuclear factor protein GmNFYB and coding gene and application thereof
  • Soy nuclear factor protein GmNFYB and coding gene and application thereof
  • Soy nuclear factor protein GmNFYB and coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Embodiment 1, the acquisition of GmNFYB1a

[0054] Utilize Trizol reagent to extract soybean (Glycine max) (Dongnong 50, Wu Tianlong , Yang Qingkai , Ma Zhanfeng , Wu Zongpu , Zhao Shuwen , Gao Fenglan , Li Wenbin , Zhang Guodong , Yang Qi , Meng Qingxi , Wang Jinling .Report on the breeding of a new soybean variety Dongnong Xiaoliudou No. 1, [J]. Journal of Northeast Agricultural University, 1994, (25) 1:104; the public can obtain it from Northeast Agricultural University, hereinafter referred to as wild-type soybean) RNA in leaves , the first strand of cDNA was synthesized by reverse transcription as a template, with sense primer: 5'GGGTATACTTGACCAAAG3' (SEQ ID NO.3), antisense primer: 5'TTAGGTAACCCAAATTCAGGAGAAAACT3', PCR reaction was carried out, and the PCR condition was 94°C for 5min; 38 One cycle: 94°C for 30s, 50°C for 30s, 72°C for 30s; 72°C for 10min. The PCR product was detected by electrophoresis on a 1.0% agarose gel, and the result show...

Embodiment 2

[0055] Example 2, GmNFYB1a subcellular localization observation

[0056] Transformation of onion epidermis with pCAMBIA1302-GmNFYB1a Agrobacterium infection method: Cut the fresh onion into small pieces of 1cm×1cm with a knife, then tear off the epidermis with tweezers and place it on MS medium for 24h (14h light, 10h dark); When the transformed pCAMBIA1302-GmNFYB1a Agrobacterium was added to YEP (containing kan, str, rif three antibiotics) and shaken to OD value 0.6-0.8, pipette the bacterial solution into YEP without antibiotics, shake to OD value 0.6-0.8, and use Centrifuge in a 50mL centrifuge tube, remove the supernatant, resuspend with YEP without antibiotics, add 1mL of acetosyringone (100μM); soak the pre-cultured onion epidermis in the resuspension solution for 40-60min, take out the onion epidermis, absorb water Blot the excess bacterial solution on the paper, and then culture in MS medium for 36-48 hours in the dark: observe the expression of green fluorescent prote...

Embodiment 3

[0058] Example 3, Obtaining and Functional Research of Transgenic GmNFYB1a Arabidopsis

[0059] 1. Construction of plant expression vector pCAMBIA

[0060] The vector pCAMBIA3301 vector (sold by CAMBIA, Australia) was digested with the restriction endonuclease BglⅡ, and the 11307bp fragment was recovered after digestion, and then the end of the fragment was smoothed with T4 polymerase, and then purified with the restriction endonuclease BstEⅡ Cut and recover a large fragment of 9265bp after digestion, and the expression vector pCAMBIA3301 was constructed.

[0061] The PCR product obtained in Example 1 was digested with sphⅠ, and the digested fragment was recovered, and then the end of the fragment was smoothed with T4 polymerase, and after purification, it was digested with the restriction endonuclease BstEⅡ. The cut pCAMBIA3301 vector fragments were connected, and the ligated product was transformed into E. coli to obtain a transformant. The plasmid of the transformant was e...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a soy nuclear factor protein GmNFYB and a coding gene and an application thereof. The soy nuclear factor protein GmNFYB provided by the invention comes from soy protein (Glycine max (L.) Merrill.) Dongnong 50 and is shown in 1) or 2): 1) protein composed of amino acid residues shown in a sequence table SEQ ID NO.2; 2) protein related to plant stress tolerance, derived from 1) and obtained by substituting and / or deleting and / or adding one or a plurality of amino acid residues in the amino acid sequence of the SEQ ID NO.2. A transgenic plant prepared by the protein GmNFYB1a provided by the invention or the coding gene thereof is higher in germination rate and longer in root under drought stress / salt stress.

Description

technical field [0001] The invention relates to soybean nuclear factor protein GmNFYB and its encoding gene and application, belonging to the field of biotechnology. Background technique [0002] Abiotic stresses such as drought and salinity seriously affect the yield and quality of crops. It is an effective way to improve the stress resistance of crops by means of genetic engineering. The elucidation of the molecular mechanism of resistance to abiotic stress is the prerequisite for the application of genetic engineering improvement. Transcription factors play a very important role in the signal transduction of abiotic stress. As an important food crop, soybean is cultivated in large areas all over the world. However, compared with other plants such as Arabidopsis thaliana, rice, maize and wheat, there is little information about NFYB transcription factors in soybean. Therefore, it has become an effective breeding method to use bioengineering technology to change the str...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N1/21C12N15/11A01H5/00
CPCC07K14/415C12N15/8273
Inventor 李文滨李永光薄蕾
Owner NORTHEAST AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More