Soy nuclear factor protein GmNFYB and coding gene and application thereof
A technology encoding genes and proteins, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problem of little research on NFYB transcription factors related information, and achieve the effect of increasing root length and increasing seed germination rate.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Embodiment 1, the acquisition of GmNFYB1a
[0054] Utilize Trizol reagent to extract soybean (Glycine max) (Dongnong 50, Wu Tianlong , Yang Qingkai , Ma Zhanfeng , Wu Zongpu , Zhao Shuwen , Gao Fenglan , Li Wenbin , Zhang Guodong , Yang Qi , Meng Qingxi , Wang Jinling .Report on the breeding of a new soybean variety Dongnong Xiaoliudou No. 1, [J]. Journal of Northeast Agricultural University, 1994, (25) 1:104; the public can obtain it from Northeast Agricultural University, hereinafter referred to as wild-type soybean) RNA in leaves , the first strand of cDNA was synthesized by reverse transcription as a template, with sense primer: 5'GGGTATACTTGACCAAAG3' (SEQ ID NO.3), antisense primer: 5'TTAGGTAACCCAAATTCAGGAGAAAACT3', PCR reaction was carried out, and the PCR condition was 94°C for 5min; 38 One cycle: 94°C for 30s, 50°C for 30s, 72°C for 30s; 72°C for 10min. The PCR product was detected by electrophoresis on a 1.0% agarose gel, and the result show...
Embodiment 2
[0055] Example 2, GmNFYB1a subcellular localization observation
[0056] Transformation of onion epidermis with pCAMBIA1302-GmNFYB1a Agrobacterium infection method: Cut the fresh onion into small pieces of 1cm×1cm with a knife, then tear off the epidermis with tweezers and place it on MS medium for 24h (14h light, 10h dark); When the transformed pCAMBIA1302-GmNFYB1a Agrobacterium was added to YEP (containing kan, str, rif three antibiotics) and shaken to OD value 0.6-0.8, pipette the bacterial solution into YEP without antibiotics, shake to OD value 0.6-0.8, and use Centrifuge in a 50mL centrifuge tube, remove the supernatant, resuspend with YEP without antibiotics, add 1mL of acetosyringone (100μM); soak the pre-cultured onion epidermis in the resuspension solution for 40-60min, take out the onion epidermis, absorb water Blot the excess bacterial solution on the paper, and then culture in MS medium for 36-48 hours in the dark: observe the expression of green fluorescent prote...
Embodiment 3
[0058] Example 3, Obtaining and Functional Research of Transgenic GmNFYB1a Arabidopsis
[0059] 1. Construction of plant expression vector pCAMBIA
[0060] The vector pCAMBIA3301 vector (sold by CAMBIA, Australia) was digested with the restriction endonuclease BglⅡ, and the 11307bp fragment was recovered after digestion, and then the end of the fragment was smoothed with T4 polymerase, and then purified with the restriction endonuclease BstEⅡ Cut and recover a large fragment of 9265bp after digestion, and the expression vector pCAMBIA3301 was constructed.
[0061] The PCR product obtained in Example 1 was digested with sphⅠ, and the digested fragment was recovered, and then the end of the fragment was smoothed with T4 polymerase, and after purification, it was digested with the restriction endonuclease BstEⅡ. The cut pCAMBIA3301 vector fragments were connected, and the ligated product was transformed into E. coli to obtain a transformant. The plasmid of the transformant was e...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 