vegetable oil body gel containing bfgf
A vegetable oil body and gel technology, applied in the biological field, can solve problems such as inconvenient use
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] According to the Chinese patent ZL200610171662.0, the announcement number CN100575488C, and the method in Example 2 of the instruction manual, the oil body expression vector p1390ONE was constructed; the nucleotide sequence of human bFGF was artificially synthesized according to the codons preferred by plants (as shown in the sequence table SEQ ID NO.1),
[0037] Using the nucleotide sequence of artificially synthesized human bFGF as a template, use primers:
[0038] P1: CAAGCTTCCAGCTTTGCCAGAGGATG
[0039] P2: GGAATTCTTAAGACTTAGCAGACATTGG
[0040] After amplification, the PCR product bFGF was digested by HindⅢ and EcoRI and then ligated to pUC19 to obtain pUCbFGF. use KpnI and Spe I After double digestion of plasmid pUCbFGF and oil body expression vector p1390ONE, the nucleotide sequence of artificially synthesized human bFGF was connected to oil body expression vector p1390ONE; the recombinant plasmid p1390ONE- bFGF ;p1390ONE- bFGF Transforming into Agrobacter...
Embodiment 2
[0042] Take 30g of safflower seeds, wash 3 times with sterilized pure water in a sterile environment, add 5 times the volume
[0043] Buffer I (0.1MTris-KOHpH7.0, 10mMKCl, 1mMMgCl 2 , 1mM EDTA, O.6M sucrose) were crushed and homogenized, filtered through three layers of gauze, and centrifuged at 6000g for 20 minutes at 4°C;
[0044] The solid material in the upper layer was resuspended with buffer I containing 0.6M sucrose, slowly added an equal volume of buffer I containing 0.1M sucrose, centrifuged at 15000g, 4°C for 20 minutes, and repeated once;
[0045] The solid matter in the upper layer was resuspended with buffer I containing 0.1M sucrose, centrifuged at 15000g, 4°C for 20 minutes, and repeated once.
[0046] The solid matter in the upper layer was fully resuspended with sucrose-free buffer I, centrifuged at 15000g, 4°C for 20 minutes, and repeated twice. The obtained upper flake is the oil body, which is set aside at 4°C.
[0047] Embodiment 3 contains the activity...
Embodiment 3
[0048] The NIH3T3 cell line was cultured completely at 37°C, 5% CO 2 Cultured, the cells are in the logarithmic growth phase, and used for the determination of biological activity. Digest and collect the cells, make 5.0×10 with complete culture medium 4 -1.0×10 5 cells / mL cell suspension, seeded in 96-well cell culture plate, 100 μL per well, 37°C, 5% CO 2 Culture, change the maintenance medium (0.3-1% serum) after 24 hours, 37°C, 5% CO 2 Incubate for 24 hours. Remove the maintenance solution from the prepared cell culture plate, add the test solution, 100 μL per well, 37°C, 5% CO 2 Incubate for 48 hours, 20 μL MTT solution per well, 37°C, 5% CO 2Incubate for 4-6 hours. After discarding the liquid in the plate, add 100 μL of DMSO to the well, mix well, put it into a microplate reader, measure the absorbance at 570 nm with 630 nm as the reference wavelength, and record the measurement results. Calculate the biological activity of the test sample.
[0049] Depend on fig...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 