Unlock instant, AI-driven research and patent intelligence for your innovation.

vegetable oil body gel containing bfgf

A vegetable oil body and gel technology, applied in the biological field, can solve problems such as inconvenient use

Active Publication Date: 2016-05-04
JILIN AGRICULTURAL UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In order to prolong the biological activity of the stock solution as much as possible, at present, recombinant human basic fibroblast growth factor (bFGF) for external use and human acidic fibroblast growth factor bFGF for external use are all made into freeze-dried dosage forms to achieve the purpose of prolonging the biological activity. That is, the validity period can be extended, the drug effect can be guaranteed, and it has the characteristics of high safety, non-toxicity, and easy to carry. However, when using the freeze-dried dosage form for external use, it needs to be diluted first, and then apply it on the affected area with a cotton ball Wipe, inconvenient to use

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • vegetable oil body gel containing bfgf

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] According to the Chinese patent ZL200610171662.0, the announcement number CN100575488C, and the method in Example 2 of the instruction manual, the oil body expression vector p1390ONE was constructed; the nucleotide sequence of human bFGF was artificially synthesized according to the codons preferred by plants (as shown in the sequence table SEQ ID NO.1),

[0037] Using the nucleotide sequence of artificially synthesized human bFGF as a template, use primers:

[0038] P1: CAAGCTTCCAGCTTTGCCAGAGGATG

[0039] P2: GGAATTCTTAAGACTTAGCAGACATTGG

[0040] After amplification, the PCR product bFGF was digested by HindⅢ and EcoRI and then ligated to pUC19 to obtain pUCbFGF. use KpnI and Spe I After double digestion of plasmid pUCbFGF and oil body expression vector p1390ONE, the nucleotide sequence of artificially synthesized human bFGF was connected to oil body expression vector p1390ONE; the recombinant plasmid p1390ONE- bFGF ;p1390ONE- bFGF Transforming into Agrobacter...

Embodiment 2

[0042] Take 30g of safflower seeds, wash 3 times with sterilized pure water in a sterile environment, add 5 times the volume

[0043] Buffer I (0.1MTris-KOHpH7.0, 10mMKCl, 1mMMgCl 2 , 1mM EDTA, O.6M sucrose) were crushed and homogenized, filtered through three layers of gauze, and centrifuged at 6000g for 20 minutes at 4°C;

[0044] The solid material in the upper layer was resuspended with buffer I containing 0.6M sucrose, slowly added an equal volume of buffer I containing 0.1M sucrose, centrifuged at 15000g, 4°C for 20 minutes, and repeated once;

[0045] The solid matter in the upper layer was resuspended with buffer I containing 0.1M sucrose, centrifuged at 15000g, 4°C for 20 minutes, and repeated once.

[0046] The solid matter in the upper layer was fully resuspended with sucrose-free buffer I, centrifuged at 15000g, 4°C for 20 minutes, and repeated twice. The obtained upper flake is the oil body, which is set aside at 4°C.

[0047] Embodiment 3 contains the activity...

Embodiment 3

[0048] The NIH3T3 cell line was cultured completely at 37°C, 5% CO 2 Cultured, the cells are in the logarithmic growth phase, and used for the determination of biological activity. Digest and collect the cells, make 5.0×10 with complete culture medium 4 -1.0×10 5 cells / mL cell suspension, seeded in 96-well cell culture plate, 100 μL per well, 37°C, 5% CO 2 Culture, change the maintenance medium (0.3-1% serum) after 24 hours, 37°C, 5% CO 2 Incubate for 24 hours. Remove the maintenance solution from the prepared cell culture plate, add the test solution, 100 μL per well, 37°C, 5% CO 2 Incubate for 48 hours, 20 μL MTT solution per well, 37°C, 5% CO 2Incubate for 4-6 hours. After discarding the liquid in the plate, add 100 μL of DMSO to the well, mix well, put it into a microplate reader, measure the absorbance at 570 nm with 630 nm as the reference wavelength, and record the measurement results. Calculate the biological activity of the test sample.

[0049] Depend on fig...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides plant oil bodies containing bFGF, which is the 3' end of the oil body protein nucleotide sequence connected to the oil body expression vector p1390ONE by connecting the nucleotide sequence of human bFGF to the oil body of oil crops to express bFGF , the extracted oil body; the present invention also provides a vegetable oil body gel containing bFGF, which is prepared by mixing with the gel matrix of the oil body, and the gel matrix of the oil body is made of the following components by weight %Composition: carboxyethyl cellulose 1%-5%, glycerin 5%-40%, methylparaben 0.01%-0.1%, propylparaben 0.01%-0.1%, add water for injection to 100%; It can be mixed with 30% vegetable oil body, stored at 37°C for 12 months, the gel has no mildew phenomenon, its appearance, pH and other physical and chemical indicators have not changed; stored at 4°C for 12 months, the activity of bFGF has no obvious change.

Description

technical field [0001] The invention relates to the field of biological technology, and specifically relates to a vegetable oil body containing bFGF, a vegetable oil body gel containing bFGF and a preparation method thereof. Background technique [0002] The oil body is composed of a single layer of phospholipid membrane, which contains TAG, and the surface is inlaid with oil body protein, calcium binding protein and sterol binding protein. TAG stored in oil bodies provides energy for seed germination. Oleosins are the major membrane proteins in oil bodies. It is a basic hydrophobin composed of three parts: the lipophilic N-terminus and C-terminus, and the intermediate hydrophobic region. The N-terminus and C-terminus are inlaid on the surface of the oil body and exposed in the cytoplasm. The hydrophobic region in the middle enters the interior of the oil body through the phospholipid membrane. So it creates electrical resistance and electrostatic repulsion, allowing the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N5/10A61K38/18A61K47/42A61K38/38A61K9/06A61P17/02A61P25/00A61P19/08A61K31/727
Inventor 李海燕李校堃官丽莉王法微杨晶姜潮董园园杜林娜王南刘秀明姚娜王艳芳
Owner JILIN AGRICULTURAL UNIV