Preparation method of human neutrophil gelatinase associated lipocalin (NGAL)
A neutrophil and apolipoprotein technology, which is applied in the field of preparation of recombinant human neutrophil gelatinase-related apolipoprotein, can solve the problems of low integration efficiency of circular plasmids, imperfect processing and modification systems, cumbersome purification, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] The preparation method of human neutrophil gelatinase-associated apolipoprotein (NGAL) in this embodiment comprises the following steps:
[0069] 1. Construction of pPICZαB-NGAL expression vector
[0070] (1) Whole gene synthesis of NGAL: chemically synthesize the nucleotide sequence of the NGAL gene according to the codon preference of Pichia pastoris, and the final gene is the base sequence shown in SEQ ID NO:1.
[0071] (2) Use the above-mentioned synthesized base sequence as a template, and use the three designed primers as upstream and downstream primers to perform nested PCR amplification. The primers required for the first PCR are as follows:
[0072] Upstream primer NGAL-U1 (5'His underlined):
[0073] GAAGCT CATCACCACCATCACCAT CAAGACTCCACCTCTGACTT
[0074] Downstream primer NGAL-R (notI site is underlined):
[0075] TTCTT GCGGCCGC TTATCAACCGTCGATACATTGGTCGA
[0076] The first PCR reaction system is:
[0077]
[0078] The amplification conditions are...
Embodiment 2
[0123] The method used in this example is basically the same as the method used in Example 1. The method described here mainly includes primer design, PCR and its product purification, restriction endonuclease digestion treatment, T4 ligase connection, transformation Cloning and identification of strains, induced expression, purification after expression, enzyme activity detection methods, etc.
[0124] The difference from Example 1 is that Pichia pastoris (Pichia pastoris) GS-115 was selected to express NGAL after the construction of the recombinant NGAL engineering bacteria was completed.
[0125] The previous results of PCR, clone identification, protein expression and protein purification are basically the same as in Example 1, and will not be repeated here.
[0126] The constructed recombinant expression vector NGAL-pPICZαB of human neutrophil gelatinase-associated apolipoprotein yeast system was introduced into GS-115 Pichia pastoris competent cells, and experiments such...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com