Fluorescent quantitative PCR detection primers, probes and kits for porcine pseudorabies virus wild strains
A porcine pseudorabies virus, detection kit technology, applied in the direction of microbial determination/inspection, biochemical equipment and methods, DNA/RNA fragments, etc. problems such as low sensitivity, to achieve the effect of high specificity and sensitivity, fast diagnosis, and simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Embodiment 1 fluorescence quantitative PCR method detects porcine pseudorabies virus field strain
[0020] According to the gE genome sequence of porcine pseudorabies virus registered in NCBI, accession numbers: AY170318, AF403049, EF552427, KC415026, KC415029, KC415028, KC415027EU561349, JF797219 provided information, after comparative analysis, primers and probes for fluorescent quantitative PCR were designed, The sequences of the primers are shown in SEQ ID NO:1 and SEQ ID NO:2, and the sequences of the probes are shown in SEQ ID NO:3.
[0021] SEQ ID NO: 1: AACCGGAAGTGACGAATGGA;
[0022] SEQ ID NO: 2: CGGTTCTCCCGGTATTTAAGC;
[0023] SEQ ID NO: 3: CCAACCGCCTGTTGATGTCCCG.
[0024] The fluorescent quantitative PCR amplification is carried out by using the above primers and probes, and the wild strain of porcine pseudorabies virus can be quickly and accurately identified through the amplification curve. The specific fluorescent quantitative PCR method is:
[0025] (...
Embodiment 2
[0037] Fluorescent quantitative PCR detection kit of embodiment 2 porcine pseudorabies virus field strain
[0038]A fluorescent quantitative PCR detection kit for wild strain of porcine pseudorabies virus, comprising primers shown in SEQ ID NO: 1 and SEQ ID NO: 2 and a probe shown in SEQ ID NO: 3. The kit also includes a quantitative PCR master mix consisting of the following components: 10 μL of premixed enzyme system, 0.2 μL of primers shown in SEQ ID NO:1, 0.2 μL of primers shown in SEQ ID NO:2, and 0.2 μL of primers shown in SEQ ID NO: : 0.1 μL of the probe indicated in 3, 0.04 μL of ROX, and 7.46 μL of sterile double-distilled water.
Embodiment 3
[0039] Embodiment 3 Specificity test
[0040] With the positive disease material grinding liquid as a positive control, against porcine transmissible gastroenteritis virus, porcine rotavirus, porcine reproductive and respiratory syndrome virus, porcine circovirus, swine fever virus, porcine pseudorabies vaccine 6 viruses, Using the primers and probes described in Example 1, the fluorescent quantitative PCR method described in Example 1 was used for specific detection. Porcine transmissible gastroenteritis virus, porcine rotavirus and porcine circovirus were positive disease materials. Porcine reproductive and respiratory syndrome virus, swine fever virus and porcine pseudorabies were all purchased from commercial vaccines on the market. The reproductive and respiratory syndrome virus was Dahuanong JXA1-R vaccine, the swine fever virus was Guangdong Yongshun C-strain cell vaccine virus, and the porcine pseudorabies was Dahuanong Bartha-K61 (pseudo-Lanwei) vaccine. Test results...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More