Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cyclodextrin glycosyl transferase and preparation method and application thereof

A glycosyltransferase, cyclodextrin technology, applied in the directions of glycosyltransferase, transferase, botanical equipment and methods, etc. 2G mass production and other issues

Active Publication Date: 2014-09-03
JIANGSU CHENGXIN PHARMA
View PDF2 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The main problems of using CGTase to produce AA-2G in the prior art are: 1) the thermostability and storage stability of the enzyme are relatively poor, which is not suitable for the production of AA-2G; 2) the conversion rate is not high, and the lower yield limit mass production of the AA-2G

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cyclodextrin glycosyl transferase and preparation method and application thereof
  • Cyclodextrin glycosyl transferase and preparation method and application thereof
  • Cyclodextrin glycosyl transferase and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach

[0049] Below in conjunction with specific embodiment, further illustrate the present invention. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0050] Experimental instruments, materials and reagents involved in this embodiment: the following table

[0051] Table 1

[0052]

[0053] Table 2

[0054]

[0055]

Embodiment 1

[0056] Example 1: Thermoanaerobacterium xylanolyticum LX-11 gene DNA

[0057] The CGT sequence of Thermoanaerobacterium xylanolyticum LX-11 strain was published by NCBI (Sequence ID: ref|YP_004470341.1|), synthesized by Zhongmei Taihe Company. Such as The amino acid sequence shown in SEQ ID NO: 2 is commercially available.

Embodiment 2

[0058] Example 2: Obtaining of DNA fragments encoding wild-type CGTase

[0059] Primers were designed as follows:

[0060] cgt-F:GGAATTCCATATGAAAAAAACCTTCAAAC

[0061] cgt-R:CGCGGATCCAATCTGCTGCCAGTTAACG

[0062] Using the above primers, the cgt gene was amplified by PCR using the genomic DNA extracted in Example 1 as a template.

[0063] The PCR reaction was carried out in a 50 μl system: 0.5 μl of PrimeStar DNA polymerase, 10 μl of 5×PS buffer, 4 μl of 10 mMdNTP, 2 μl of upstream and downstream primers, 1 μl of template DNA, and added water to make up to 50 μl.

[0064] The reaction conditions were denaturation at 94°C for 5 min, followed by denaturation at 94°C for 45 s, annealing at 55°C for 15 s, extension at 72°C for 2 min, and a total of 30 cycles, followed by extension at 72°C for 10 min. A PCR fragment of about 2100bp was amplified.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a novel cyclodextrin glycosyl transferase and a preparation method and application thereof, wherein the novel cyclodextrin glycosyl transferase is a mutant with the mutation at 55 bit, 77 bit, 121 bit, 331 bit, 543 bit, 604 bit or 615 bit of an amino acid sequence shown in SEQ ID NO:2. The novel cyclodextrin glycosyl transferase has good thermal stability, good storage stability, and high activity, can be used in the production of AA-2G, can increase the yield and improve the conversion rate of vitamin C, and is suitable for large scale production of the AA-2G. By use of the new CGT (cyclodextrin glycosyl transferase), the AA2G yield can reach 170g / L, the conversion rate of vitamin C can reach 55%-60%.

Description

technical field [0001] The invention belongs to the field of genetic engineering and enzyme engineering, and relates to a cyclodextrin glycosyltransferase and its variants for synthesizing AA-2G with β-cyclodextrin and vitamin C as substrates, specifically derived from Thermoanaerobacterium xylanolyticum LX- 11 Cyclodextrin glycosyltransferases of CGTase (cyclomaltodextringlucanotransferase) and variants thereof. Background technique [0002] Vitamin C is a water-soluble vitamin that cannot be synthesized by the human body and plays an important physiological role in the body. However, due to the extreme instability caused by strong reducibility, its application is greatly limited. Therefore, since the last century, the development of vitamin C derivatives that can not only ensure the normal physiological functions of vitamin C but also have good stability is called as a research hotspot. [0003] 2-Oxy-α-D-glucopyranosyl ascorbic acid (AA-2G) is a carbohydrate derivative ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/10C12N15/54C12P19/60
CPCC12N9/1074C12P19/60C12Y204/01019
Inventor 邢将军
Owner JIANGSU CHENGXIN PHARMA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com