Cyclodextrin glycosyl transferase and preparation method and application thereof
A glycosyltransferase, cyclodextrin technology, applied in the directions of glycosyltransferase, transferase, botanical equipment and methods, etc. 2G mass production and other issues
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific Embodiment approach
[0049] Below in conjunction with specific embodiment, further illustrate the present invention. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.
[0050] Experimental instruments, materials and reagents involved in this embodiment: the following table
[0051] Table 1
[0052]
[0053] Table 2
[0054]
[0055]
Embodiment 1
[0056] Example 1: Thermoanaerobacterium xylanolyticum LX-11 gene DNA
[0057] The CGT sequence of Thermoanaerobacterium xylanolyticum LX-11 strain was published by NCBI (Sequence ID: ref|YP_004470341.1|), synthesized by Zhongmei Taihe Company. Such as The amino acid sequence shown in SEQ ID NO: 2 is commercially available.
Embodiment 2
[0058] Example 2: Obtaining of DNA fragments encoding wild-type CGTase
[0059] Primers were designed as follows:
[0060] cgt-F:GGAATTCCATATGAAAAAAACCTTCAAAC
[0061] cgt-R:CGCGGATCCAATCTGCTGCCAGTTAACG
[0062] Using the above primers, the cgt gene was amplified by PCR using the genomic DNA extracted in Example 1 as a template.
[0063] The PCR reaction was carried out in a 50 μl system: 0.5 μl of PrimeStar DNA polymerase, 10 μl of 5×PS buffer, 4 μl of 10 mMdNTP, 2 μl of upstream and downstream primers, 1 μl of template DNA, and added water to make up to 50 μl.
[0064] The reaction conditions were denaturation at 94°C for 5 min, followed by denaturation at 94°C for 45 s, annealing at 55°C for 15 s, extension at 72°C for 2 min, and a total of 30 cycles, followed by extension at 72°C for 10 min. A PCR fragment of about 2100bp was amplified.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 