Protein nanoparticle containing bioactivity oligopeptide-ferritin heavy chain subunit and preparation method of protein nanoparticle

A ferritin heavy chain and biologically active technology, which is applied in the field of protein nanoparticles containing bioactive short peptide-ferritin heavy chain subunits and its preparation, can solve problems such as incorrect folding and assembly, and achieve the goal of avoiding interactions Effect

Inactive Publication Date: 2014-09-24
EAST CHINA UNIV OF SCI & TECH
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The technical problem to be solved by the present invention is that for the short peptides of the α-helical structure of HSA or the short peptides of the random coil conformation of elastin, when they are fused to the N-terminal of ferritin and refolded in vitro, they cannot be correct. For the problem of folding and assembly, a multifunctional protein nanoparticle containing a biologically active short peptide-ferritin heavy chain subunit and its preparation method are provided

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein nanoparticle containing bioactivity oligopeptide-ferritin heavy chain subunit and preparation method of protein nanoparticle
  • Protein nanoparticle containing bioactivity oligopeptide-ferritin heavy chain subunit and preparation method of protein nanoparticle
  • Protein nanoparticle containing bioactivity oligopeptide-ferritin heavy chain subunit and preparation method of protein nanoparticle

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 Construction of pET28a(+) / HSA-1-FTH1 expression engineering bacteria:

[0037] According to the sequence of the target gene, a pair of forward and reverse primers were designed and named as HSA-1-F1 and HSA-1-R1, HSA-1-F2 and HSA-1-R2. Design appropriate protective bases and restriction sites on both sides of the target sequence, the restriction sites are EcoR I and Nco I. Firstly, HSA-1-F2 and HSA-1-R2 were used as primers and templates to carry out the first round of PCR to obtain corresponding products. Then use HSA-1-F1 and HSA-1-R1 as PCR primers, and use the product of the first round as a template to carry out the second round of PCR to obtain the target gene fragment HSA-1. Subsequently, the target gene fragment was double digested and inserted between the restriction sites EcoR I and Nco I of the pET-28(+)-FTH1 plasmid to obtain the target recombinant plasmid.

[0038] The following is the primer sequence of HSA-1, the sequence is in the 5'-3' direc...

Embodiment 2

[0052] The preparation of embodiment 2HSA-1-FTH1 target protein

[0053] Induction of the obtained Pet28a(+) / HSA-1: FTH1 expression bacteria prepared in Example 1 to express HSA-1: FTH1 target protein: pick the monoclonal engineering expression colony from the plate, and put it in 25ml LB liquid medium (40% NaCI, 40% Tryptone, 20% Yeast Extract, kanamycin 50 μg / ml), placed in a constant temperature shaker at 37° C., 200 rpm, and cultured overnight. On the next day, inoculate 1% of the inoculum into 200ml LB liquid medium (the composition and antibiotic concentration are the same as above). As for the 37°C constant temperature shaker, when the OD is about 0.6, add a final concentration of 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG), and induce overnight at 37°C. Finally, the bacterial cells were collected by centrifugation at 4°C and 5000 rpm for 30 minutes, and the bacterial cells were stored at -20°C.

Embodiment 3

[0054] The preparation of embodiment 3HSA-3-FTH1 target protein

[0055] The pET28a(+) / HSA-3-FTH1 expressing engineered strain was constructed and induced to express HSA-3-FTH1 protein. The PCR reaction steps and the establishment and expression methods of the expressing engineered strain were as described in Examples 1 and 2.

[0056] The following is the primer sequence of HSA-3, the sequence is in the 5'-3' direction:

[0057] HSA-3-F1 (SEQ ID NO: 13):

[0058] TCATGCCATGGCAAAGGAACAGCTAAAGGCAGTAATGGACGACTTCGCAGCAT;

[0059] HSA-3-R1 (SEO ID NO: 14):

[0060] ACCGGAATTCACTTCCTCCTCCTCCACTT CCTCCTCCTCCGTCGACACAC;

[0061] HSA-3-F2 (SEQ ID NO: 15):

[0062] CAGTAATGGACGACTTCGCAGCATTCGTAGAAAAGTGTGTC;

[0063] HSA-3-R2 (SEQ ID NO: 16):

[0064] TCCTCCTCCTCCGTCGACACACTTTTTCTACGAATGCTGC.

[0065] The amino acid sequence of the HAS-3 active short peptide is shown in SEQ ID NO: 2 in the sequence listing, and the amino acid sequence of the obtained HSA-3-FTH1 target fusion prot...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a protein nanoparticle containing a bioactivity oligopeptide-ferritin heavy chain subunit and a preparation method of the protein nanoparticle. The preparation method comprises the following steps: amplifying a fragment of a fusion gene of the bioactivity oligopeptide-ferritin heavy chain subunit by adopting an overlapping PCR (polymerase chain reaction) technology, inserting the amplified fragments into a pET28a(+) carrier, and transforming the carrier into a DH5 alpha competent cell to obtain expression engineering bacteria and an inclusion body; uniformly mixing the diluted bioactivity oligopeptide-ferritin heavy chain subunit inclusion body and an EGF (epidermal growth factor)-ferritin heavy chain subunit inclusion body according to a molar ratio of 6:4, and performing dialysis and renaturation on the uniformly mixed solution in a dialysis bag to obtain the multi-functionalized protein nanoparticle containing the bioactivity oligopeptide-ferritin heavy chain subunit. The obtained protein nanoparticle has a targeting function and also has spacing and stabilizing effects on modification of bioactivity oligopeptides; the interaction among oligopeptides is avoided, so that the functionalization of the protein nanoparticle is made possible.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a protein nanoparticle containing a bioactive short peptide-ferritin heavy chain subunit and a preparation method thereof. Background technique [0002] Protein cages are natural biological macromolecules, so they have good biocompatibility. They are usually hollow structures formed by the combination of multiple polypeptide subunits, and both the outer diameter and the diameter of the middle cavity are in the nanoscale range. Recently, with the integration of genetic engineering, protein chemical modification technology and nanotechnology, the easy modification of the surface, interior and protein subunit interface of this kind of bionanomaterials determines that they can effectively assemble various functional molecules to construct Multifunctional nanodevices have thus attracted widespread attention and interest. People can endow this kind of biological nanomaterials...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00B82Y30/00A61K38/16A61P35/00C12N15/70
Inventor曹旭妮沈阳王焦清
OwnerEAST CHINA UNIV OF SCI & TECH