A universal primer and real-time fluorescent thda kit for detecting Aspergillus flavus and Aspergillus fumigatus

A real-time fluorescence and kit technology, applied in recombinant DNA technology, DNA/RNA fragments, microorganisms, etc., can solve the problems of inability to quantitatively analyze the starting template and low sensitivity, and achieve shortened hospitalization time, high sensitivity, and simplified instruments Effect

Active Publication Date: 2016-03-23
FUJIAN MEDICAL UNIV UNION HOSPITAL
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Only using tHDA amplification technology to qualitatively or quantitatively analyze the final product cannot accurately quantify the initial template, while real-time fluorescent tHDA technology uses the change of fluorescence signal to monitor the change of the amount of amplification product in each cycle of HDA amplification reaction in real time. Quantitative analysis of the starting template can be carried out through the analysis of Ct value and its standard curve
However, the tHDA amplification technology is currently in its infancy in the world, although the existing tHDA amplification technology is used in the detection of Aspergillus (Wang Xiaoting. Research on Helicase-dependent DNA Constant Temperature Amplification Technology for Aspergillus flavus detection [D ]. Fujian Medical University, 2012.), but its sensitivity is low, and the starting template cannot be quantitatively analyzed. At present, no real-time fluorescent tHDA technology has been applied to the detection of Aspergillus at home and abroad.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A universal primer and real-time fluorescent thda kit for detecting Aspergillus flavus and Aspergillus fumigatus
  • A universal primer and real-time fluorescent thda kit for detecting Aspergillus flavus and Aspergillus fumigatus
  • A universal primer and real-time fluorescent thda kit for detecting Aspergillus flavus and Aspergillus fumigatus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Embodiment 1: Aspergillus tHDA primer design and synthesis

[0045] According to the mitochondrial gene sequence of Aspergillus fumigatus in Genbank, select the conserved sequence of Aspergillus, design primers through IDT online primer design, obtain the universal Aspergillus primers for tHDA amplification including forward primer (its sequence is TGCATTTAATAGCAATGCACGATAC) and reverse primer ( Its sequence is TGCATTTAATAGCAATGCACGATAC) The primer was synthesized by Shanghai Yingwei Jieji Company.

Embodiment 2

[0046] Example 2: Preparation of a fluorescent quantitative tHDA rapid diagnostic kit for detecting invasive Aspergillus. The kit includes DNA extraction reagent, real-time fluorescence quantitative tHDA reaction solution and plasmid template quantitative standard

[0047] One, DNA extraction agent, it comprises following component:

[0048] 1. BufferⅠ: It is a cell lysate, including 0.5% sodium dodecyl sulfate (SDS), 0.1mol / LNaCl, 0.05mol / L Tris-Cl (pH7.6), 1mmol / L ethylenediaminetetraacetic acid ( EDTA);

[0049] 2. Buffer II: It is a fungal wall breaking solution, containing 500mmol / LTris; 10mmol / LEDTA; 1% β-mercaptoethanol;

[0050] 3. BufferⅢ is phenol: chloroform: isoamyl alcohol (25:24:1);

[0051] 4. Proteinase K (10U / ul);

[0052] 5. Lyticase (10U / ul);

[0053] 2. Real-time fluorescent quantitative tHDA reaction solution

[0054] The tHDA reaction solution includes: 10×tHDA buffer, 20uM forward primer, 20uM reverse primer, 100mMMgSO4, 500mMNaCl, dNTP mixture, en...

Embodiment 3

[0060] Example 3 Sensitivity and specificity analysis of Aspergillus detection by real-time fluorescent quantitative tHDA

[0061] In this example, the sensitivity analysis of real-time fluorescent quantitative tHDA is carried out by detecting the positive standard substances under different gradients, and the concentration of the lowest positive standard substance is obtained as a sensitivity index. As an amplification template, it was observed whether non-specific amplification was possible.

[0062] 1. Several reaction tubes were taken for sensitivity analysis and specificity analysis and detection respectively. The sample volume of tHDA system was carried out according to Table 1. The real-time fluorescent tHDA quantitative analysis was detected by ABI7500 quantitative instrument.

[0063] Table 1 shows the real-time fluorescence quantitative tHDA reaction system

[0064] components

Sample volume (ul)

10×tHDA buffer

5.0

MgSO4(100mM)

2.0 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a universal primer for detecting aspergillus flavus and aspergillus fumigatus and a real-time fluorescence tHDA (Thermophilic Helicase Dependent Amplification) kit. The universal primer can be used for simultaneously detecting the aspergillus fumigatus and the aspergillus flavus in an amplification manner and is simultaneously combined with a real-time fluorescence tHDA technology. Thus, compared with other common PCR (Polymerase Chain Reactions), according to the universal primer, the amplification can be carried out at a constant temperature, so that the processes of denaturation, annealing, extending and the like are omitted, i.e., the helicase amplification can be carried out by directly simulating a biology environment, which is favorable for simplification of equipment and popularization of the universal primer in grass roots. The detection limit of the real-time fluorescence tHDA kit can reach 104copies / ml, so that the real-time fluorescence tHDA kit is suitable for clinical applications. The real-time fluorescence tHDA kit can be used for detecting two types of aspergillus infections which are the most common in clinical, so that a large quantity of precious rescue time in clinical can be saved and the kit is low in cost and convenient to operate. Thus, the real-time fluorescence tHDA kit has a wide application prospect.

Description

technical field [0001] The invention belongs to the field of in vitro diagnostic nucleic acid detection, and in particular relates to a fluorescent tHDA (thermostable helicase-dependent constant temperature amplification) kit for detecting infection of Aspergillus fumigatus and Aspergillus flavus in clinical samples. Background technique [0002] In recent years, with the increase of tumor patients, the widespread use of chemotherapy drugs, immunosuppressants and broad-spectrum antibiotics, especially in malignant hematological diseases and bone marrow transplantation, the incidence of invasive fungal infection has increased significantly, and Aspergillus infection It is an invasive fungal infection second only to Candida infection and is increasing year by year. Studies have shown that the mortality rate of pulmonary Aspergillus infection is 40%, and that of generalized Aspergillus infection is 90%. Aspergillus has become the primary pathogen in the autopsy cases of repeat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11C12R1/68C12R1/67
CPCC12Q1/6844C12Q2521/513C12Q2563/107C12Q2561/113
Inventor 沈建箴肖世极吴淡森付海英周华蓉黄金梅黄劲龙王小婷张胜蓝
Owner FUJIAN MEDICAL UNIV UNION HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products