A universal primer and real-time fluorescent thda kit for detecting Aspergillus flavus and Aspergillus fumigatus
A real-time fluorescence and kit technology, applied in recombinant DNA technology, DNA/RNA fragments, microorganisms, etc., can solve the problems of inability to quantitatively analyze the starting template and low sensitivity, and achieve shortened hospitalization time, high sensitivity, and simplified instruments Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Embodiment 1: Aspergillus tHDA primer design and synthesis
[0045] According to the mitochondrial gene sequence of Aspergillus fumigatus in Genbank, select the conserved sequence of Aspergillus, design primers through IDT online primer design, obtain the universal Aspergillus primers for tHDA amplification including forward primer (its sequence is TGCATTTAATAGCAATGCACGATAC) and reverse primer ( Its sequence is TGCATTTAATAGCAATGCACGATAC) The primer was synthesized by Shanghai Yingwei Jieji Company.
Embodiment 2
[0046] Example 2: Preparation of a fluorescent quantitative tHDA rapid diagnostic kit for detecting invasive Aspergillus. The kit includes DNA extraction reagent, real-time fluorescence quantitative tHDA reaction solution and plasmid template quantitative standard
[0047] One, DNA extraction agent, it comprises following component:
[0048] 1. BufferⅠ: It is a cell lysate, including 0.5% sodium dodecyl sulfate (SDS), 0.1mol / LNaCl, 0.05mol / L Tris-Cl (pH7.6), 1mmol / L ethylenediaminetetraacetic acid ( EDTA);
[0049] 2. Buffer II: It is a fungal wall breaking solution, containing 500mmol / LTris; 10mmol / LEDTA; 1% β-mercaptoethanol;
[0050] 3. BufferⅢ is phenol: chloroform: isoamyl alcohol (25:24:1);
[0051] 4. Proteinase K (10U / ul);
[0052] 5. Lyticase (10U / ul);
[0053] 2. Real-time fluorescent quantitative tHDA reaction solution
[0054] The tHDA reaction solution includes: 10×tHDA buffer, 20uM forward primer, 20uM reverse primer, 100mMMgSO4, 500mMNaCl, dNTP mixture, en...
Embodiment 3
[0060] Example 3 Sensitivity and specificity analysis of Aspergillus detection by real-time fluorescent quantitative tHDA
[0061] In this example, the sensitivity analysis of real-time fluorescent quantitative tHDA is carried out by detecting the positive standard substances under different gradients, and the concentration of the lowest positive standard substance is obtained as a sensitivity index. As an amplification template, it was observed whether non-specific amplification was possible.
[0062] 1. Several reaction tubes were taken for sensitivity analysis and specificity analysis and detection respectively. The sample volume of tHDA system was carried out according to Table 1. The real-time fluorescent tHDA quantitative analysis was detected by ABI7500 quantitative instrument.
[0063] Table 1 shows the real-time fluorescence quantitative tHDA reaction system
[0064] components
Sample volume (ul)
10×tHDA buffer
5.0
MgSO4(100mM)
2.0 ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
