Monoclonal antibody, antigen and gene, and application thereof
A monoclonal antibody and gene technology, applied in genetic engineering, plant genetic improvement, application, etc., can solve the problems of difficult to prepare anti-NP antibodies, high price, long cycle, etc., and achieve high fluorescence intensity and durability, and high titer. Effect
Active Publication Date: 2015-07-22
BEIJING APOLLO MEDICAL SCI & TECH CO LTD
View PDF1 Cites 0 Cited by
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
[0003] The yield of rabies virus in cell culture is low, it is difficult to obtain a large amount of purified NP from rabies virus particles, and the NP of rabies virus does not contain sugar groups, and its own immunity is weak, so it is difficult to prepare anti-NP antibodies
At present, there is no fluorescently labeled rabies virus nucleoprotein monoclonal antibody diagnostic reagent with a formal approval number in China for this key reagent, while imported products are expensive and have a long cycle. It has not been established, which has seriously affected the clinical diagnosis of rabies, vaccine quality control and epidemiological investigation.
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View moreImage
Smart Image Click on the blue labels to locate them in the text.
Smart ImageViewing Examples
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0029] (1) Preparation of antigenic protein
[0030] Referring to chapters 7-8 of the third edition of "Molecular Cloning Experiment Guide" (J. Sambrook et al., Science Press, 2002), extract the total RNA of rabies virus-infected cells (this operation is entrusted to the Chinese Center for Disease Control and Prevention) 1. The corresponding cDNA is obtained by reverse transcription, and PCR amplification is performed using the cDNA obtained by reverse transcription as a template. The upstream primer used in PCR is shown in SEQ ID NO: 5, and the downstream primer is shown in SEQ ID NO: 6.
[0031] Upstream primer: 5'-GAACCATATGGATGCCGACAAGATTGTG-3' (SEQ ID NO: 5)
[0032] Downstream primer: 5'-ACCTCGAGTTATGAGTCATTCGAATACG-3' (SEQ ID NO: 6)
[0033] BGI was entrusted to sequence the gene obtained by PCR amplification, and its base sequence was obtained as shown in SEQ ID NO:4.
[0034] TTATGAGTCATTCGAATACGTCTTGTTTAGAAACTCGGCGAATGAGTTTGGACGGGCTTGATGATTGGAACT
[0035] GACTGAGA...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More PUM
Login to View More Abstract
Disclosed in the present invention is a tollwut virus monoclonal antibody having a light chain variable region as shown in SEQ ID NO: 1, and a heavy chain variable region as shown in SEQ ID NO: 2. The antibody can be produced by a hybridoma with the deposit number CGMCC No.7956. Also disclosed in the present invention is a protein antigen for preparing the monoclonal antibody, having the amino acid sequence as shown in SEQ ID NO: 3. This protein antigen can be encoded by the gene shown in SEQ ID NO: 4, and can be used to prepare a high-potency monoclonal antibody. The monoclonal antibody of the present invention has a potency commensurate with foreign similar products, and in RFFIT testing, it shows a relatively high fluorescence intensity and persistence.
Description
technical field [0001] The present invention relates to a rabies virus monoclonal antibody, rabies virus antigenic protein, genes encoding them and their application. Background technique [0002] The current international rapid fluorescence focus inhibition test (RFFIT) method for detecting rabies virus: a fixed amount of virus is combined with serially diluted test serum and a control serum of known titer Incubate at 37°C and add sensitive cell suspension. After further incubation, the cells formed a monolayer, at which point they were fixed with cold acetone and stained with a fluorescently labeled rabies virus nucleoprotein (NP) monoclonal antibody to detect the presence of unneutralized virus (fluorescent foci), The titer of antibodies in each serum to be tested is then calculated. Fluorescence-labeled NP antibodies are required for RFFIT detection, and sensitive and efficient fluorescent-labeled rabies virus nucleoprotein monoclonal antibody diagnostic reagents are t...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More Application Information
Patent Timeline
Login to View More Patent Type & Authority Patents(China)
IPC IPC(8): C07K16/10C12N5/20G01N33/577G01N33/569C07K14/145C12N15/47C12N15/70C12N1/21C12N15/13
CPCC12N15/70C07K14/145G01N33/56983G01N2333/145C07K16/10C07K14/005C12N2760/20122
Inventor 纪军
Owner BEIJING APOLLO MEDICAL SCI & TECH CO LTD