Engineering bacterium based on cellulose metabolic pathway key enzyme and implementation method of engineering bacterium based on cellulose metabolic pathway key enzyme

A technology of engineering bacteria and cellulose, applied in the field of engineering bacteria of β-1,4-glucosidase, can solve the problem of low expression level, and achieve the effect of ensuring quality, improving protein activity and solubility

Inactive Publication Date: 2014-12-03
SHANGHAI JIAO TONG UNIV
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The present invention is aimed at exo-β-1,4-glucanase, endo-β-1,4-glucanase and β-1,4-glucosidase in the prior art in Streptomyces grisea ( Most of Streptomyces griseorubens) are deficiencies that are induced and expressed at a very low level. An engineering bacterium based on key enzymes in the cellulose metabolism pathway and its realization method are proposed. Through whole-genome sequencing analysis, the Streptomyces genome was isolated from the Streptomyces genome and cellulose Gene sequences involved in degradation, including those encoding exo‐β‐1,4‐glucanase, endo‐β‐1,4‐glucanase, and β‐1,4‐glucosidase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering bacterium based on cellulose metabolic pathway key enzyme and implementation method of engineering bacterium based on cellulose metabolic pathway key enzyme
  • Engineering bacterium based on cellulose metabolic pathway key enzyme and implementation method of engineering bacterium based on cellulose metabolic pathway key enzyme
  • Engineering bacterium based on cellulose metabolic pathway key enzyme and implementation method of engineering bacterium based on cellulose metabolic pathway key enzyme

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] In this example, Streptomyces griseorubens was isolated from rotten bacteria collected in Pujiang Town, Shanghai.

[0031] Straw, the preservation number is CGMCC No.5706. The strain was inoculated in LB liquid medium and cultured at 32°C for 48 h.

[0032] The above LB liquid medium components are: peptone 10.0g / L, yeast extract 5.0g / L, NaCl 10.0g / L, pH 6.8-7.2. Add 15.0‐20.0g / L agar to the liquid medium to obtain LB solid medium.

[0033]1) Genomic DNA extraction of Streptomyces griseorubens: collect 2.0 mL of bacterial liquid, and centrifuge at 12000 rpm for 2 min. Discard the supernatant, collect the bacterial pellet, add 180μL lysozyme (20mg / mL) and 20μL EDTA solution (0.5M, pH8.0), treat at 37℃ for 45min, add 4μL RNase A (100mg / mL), shake and mix for 15s , placed at room temperature for 5 minutes, and then completed the remaining operations according to the instructions of the bacterial DNA extraction kit (TIANGEN) to obtain high-purity genomic DNA. The qualit...

Embodiment 2

[0038] Construction of co-expression vector

[0039] 1) According to the optimized nucleotide sequence, design the PCR primer sequence containing restriction site as follows:

[0040] EX‐Nco I‐F: TACCATGGCTGCTGTTCCGTGCACCGTTGACTACA

[0041] EX‐BamH I‐R: CGGGATCCTTAATGATGATGATGATGATGAGAAACCGGCGGGTAAGCG

[0042] EN‐Nde I‐F:TACATATGGACACCACCCCTGTGCGAAGAATTCGGT

[0043] EN‐Xho I‐R: CCCTCGAGTTAATGATGATGATGATGATGAGCGGTACGGCAAGCGGTA

[0044] BG‐Msc I‐F:GATGGCCATGGTGACCATCGACTACGCTGCTCTGC

[0045] BG‐Xho I‐R: CCCTCGAGTTAATGATGATGATGATGATGAGCAGCTTCACGAACACGT

[0046] 2) Using pUC57-EX as a template, PCR amplification was performed with primers containing Nco I and BamH I restriction sites to obtain the exo‐β‐1,4‐glucanase gene sequence, using DNA A‐Tailing Add A to Kit and connect to T‐Vector PMD TM 19‐T (TaKaRa), and the ligation product was transferred into DH5α E. coli. Positive clones were selected, and plasmids were extracted by shaking bacteria for sequencing. If correct,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an engineering bacterium based on a cellulose metabolic pathway key enzyme and an implementation method of the engineering bacterium based on the cellulose metabolic pathway key enzyme. The method comprises the following steps: building a vector as a template by whole-gene synthesis of streptomyces griseorubens genome DNA; respectively carrying out PCR amplification on the template and corresponding primers containing enzyme digestion sites, thereby respectively obtaining a nucleotide sequence of encoding exo-beta-1,4-glucanase, a nucleotide sequence of encoding endo-beta-1,4-glucanase, and a nucleotide sequence of encoding beta-1,4-glucosaccharase; sequentially connecting the amplified sequences to obtain a coexpression vector, thereby finally obtaining a recombinant coexpression vector and a recombinant expression vector; and successively transforming the recombinant coexpression carrier into an escherichia coli expression strain, so as to obtain a transgenic coexpression strain. A large number of in vitro expression synthesis of the exo-beta-1,4-glucanase, the endo-beta-1,4-glucanase and the beta-1,4-glucosaccharase is achieved by using genetic engineering means, and in-situ rapid degradation of cellulose is finally achieved.

Description

technical field [0001] The present invention relates to a gene in the technical field of biogenetic engineering and its engineering strain, specifically a kind of Streptomyces grisea based on exo-β-1,4-glucanase, endo-β-1 , 4‐glucanase and β‐1,4‐glucosidase engineering bacteria and its realization method. Background technique [0002] Lignocellulose is the most abundant natural polymer compound in the plant kingdom, and it is the main dry matter produced by plants through photosynthesis, mainly including cellulose, hemicellulose and lignin. It is estimated that the total dry weight of lignocellulose produced by photosynthesis of green plants in the world every year is 173 billion tons, and the total energy contained is as high as 2×10 18 KJ is equivalent to 10 times the energy consumed by the whole world every year. The biodegradation and depolymerization of lignocellulose is a highly complex process involving the participation of numerous enzyme systems. [0003] Cellulo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/70C12R1/19C12R1/465
Inventor周培冯海玮孙玉静支月娥罗艳青
OwnerSHANGHAI JIAO TONG UNIV