Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit capable of rapidly and specifically detecting mycobacterium tuberculosis infection and applications thereof

A Mycobacterium tuberculosis and kit technology, applied in the field of kits for detecting Mycobacterium tuberculosis infection, can solve the problems of low positive rate, time-consuming, complicated operation, etc., and achieve the effects of sequence optimization, safe use and high infection rate

Active Publication Date: 2015-01-28
HARBIN MEDICAL UNIVERSITY
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The purpose of the present invention is to overcome the shortcomings of the existing tubercle bacillus infection detection technology, such as time-consuming, low positive rate and complicated operation, and provide a convenient, highly sensitive and specific, widely applicable sRNA detection kit

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit capable of rapidly and specifically detecting mycobacterium tuberculosis infection and applications thereof
  • Kit capable of rapidly and specifically detecting mycobacterium tuberculosis infection and applications thereof
  • Kit capable of rapidly and specifically detecting mycobacterium tuberculosis infection and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Design and synthesis of primers

[0041] According to the previous research results of the laboratory, three pairs of specific primers for the free small RNA of Mycobacterium tuberculosis were independently designed and synthesized. The nucleotide sequences of the first pair of primers are listed in SEQ ID NO.1 and SEQ ID NO.2 respectively. Shown, the nucleotide sequence of the second pair of primers is respectively shown in SEQ ID NO.3 and SEQ ID NO.4, and the nucleotide sequence of the third pair of primers is respectively SEQ ID NO.5 and SEQ ID NO.6 shown (Table 1).

[0042] Table 1 Primer sets for multiplex PCR detection

[0043] SEQ ID No.1 CCACCTACTCGATGGCGTTG SEQ ID No.2 ACTTACGGGGATTGGGAGGT SEQ ID No.3 ATAGAGGACGGAGTCGATGA SEQ ID No.4 AGAAACTTCGGATCGAGGTA SEQ ID No.5 AACTCCGACAGGGCTGGAAG SEQ ID No.6 CGTGGCTATACCAAGGTCCA

Embodiment 2

[0044] Example 2 Application of multiplex PCR primer set of the present invention in detection of Mycobacterium tuberculosis infection

[0045] method:

[0046] 1. Extraction of total RNA in plasma

[0047] (1) Obtain plasma:

[0048] Collect 3-5 ml of peripheral blood from patients or normal individuals, centrifuge horizontally at 1000 g / min for 10 minutes. Carefully pipette 200 µl of the upper plasma layer into a sterile 1.5 ml centrifuge tube.

[0049] (2) total RNA extraction:

[0050] Add 500 microliters of phenolguanidine RNA extraction solution to 200 microliters of plasma, mix well, and let stand at room temperature for 5 minutes. Add 300 microliters of chloroform, mix well and centrifuge at 12000 rpm for 10 minutes. Carefully pipette the supernatant liquid into a sterile 2 ml centrifuge tube. Add 900 microliters of acetone, mix well and absorb with silica gel membrane. Rinse once with protein washing solution, rinse once with 100% ethanol and 80% ethanol in turn...

Embodiment 3

[0065] Embodiment 3 specificity experiment

[0066] The main cells (THP-1 and A549) and common infectious bacteria Escherichia coli and Klebsiella pneumoniae of two kinds of Mycobacterium tuberculosis infection are carried out PCR reaction with the primer designed by the present invention, the result is as follows Figure 5 shown.

[0067] From Figure 5 As a result, it can be seen that three pairs of primers of the present invention only show specific amplification reactions in Mycobacterium tuberculosis (BCG), but have no effect on THP-1 and A549 and common infectious bacteria Escherichia coli and Klebsiella pneumoniae. Amplification shows that the primers designed in the present invention have good specificity.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit capable of rapidly and specifically detecting mycobacterium tuberculosis infection, and comprises three pairs of specific primers for detecting free small RNA of mycobacterium tuberculosis. Specific primers are designed for detecting free small RNA of mycobacterium tuberculosis, and free small RNA is extracted from human peripheral blood, detected, and synthesized so as to obtain cDNA. Then a realtime quantitative amplification system containing gradient-diluted cDNA, and a kit and method for rapidly and specifically detecting mycobacterium tuberculosis infection are established. The kit and method solve the problems that in the prior art the diagnosis time in a lab for patients is too long, the detection sensitivity is low, and the operation is very complicated. The provided kit is capable of being used to detect mycobacterium tuberculosis in a clinical lab, and can also be used to evaluate clinical treatment effect. The provided kit has the advantages of high sensitivity, good specificity, low cost, and convenient operation on detecting mycobacterium tuberculosis, and is capable of fully filling the requirements on rapid diagnosis in clinic or lab.

Description

technical field [0001] The invention relates to a kit for detecting Mycobacterium tuberculosis infection, in particular to a kit capable of rapidly and specifically detecting Mycobacterium tuberculosis infection from human peripheral blood. The invention belongs to the field of clinical diagnosis of Mycobacterium tuberculosis. Background technique [0002] Mycobacterium tuberculosis (M.tuberculosis), commonly known as Mycobacterium tuberculosis, is the pathogenic bacteria that causes tuberculosis. It can invade all organs of the body, but tuberculosis is the most common. Tuberculosis is still an important infectious disease. An estimated one-third of the world's population is infected with Mycobacterium tuberculosis. According to the WHO, about 8 million new cases occur each year and at least 3 million people die from the disease. Before the founding of the People's Republic of my country, the mortality rate reached 200-300 people / 100,000, ranking first among the causes o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12R1/32
CPCC12Q1/686C12Q1/689C12Q2600/16C12Q2537/143C12Q2561/113C12Q2563/107
Inventor 张凤民李文静付英梅宋武琦张智玮
Owner HARBIN MEDICAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com