Unlock instant, AI-driven research and patent intelligence for your innovation.

Method utilizing gene engineering to modify enzyme to prepare terpenoid

A technology of terpenoids and genetic engineering, applied in the field of preparation methods from e,-kaurenoic acid

Inactive Publication Date: 2015-02-11
NANJING NUOYUN BIOLOGICAL TECH CO LTD
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Then insert the function of stevia kaurenoate hydroxylase (SEQ ID NO: 2) into the gibberellin strain without the function of ent-kaurenoate oxidase, and the ent-kaurenoate oxidase will The excess accumulated ent-kaurenoic acid is converted into steviol for further production of steviol glycosides, but how to solve the problem of high-efficiency expression of heterologous genes is the key to solving the problem

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method utilizing gene engineering to modify enzyme to prepare terpenoid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] The construction of embodiment 1.ent-kaurenoate oxidase gene knockout vector

[0041] Using Gibberella fujikuroi genomic DNA as a template, the left and right homology arms were amplified with the following primers, F1: 5' TGATGAGACTTGTGTCTGAGAGCTT 3'

[0042] R1: 5' AAAGGTGAAGTCCCTCTTGGC 3'

[0043] F2: 5'AGCACAGCTCGTGAGTGCCAC 3'

[0044] R2: 5' GAATATTGGAGAAATGGATGGGC 3'

[0045] Use the following primers to amplify the hygromycin gene expression cassette using pCambia1302 as a template, then connect the three fragments into the pAN7-1 backbone by homologous recombination, and obtain the correct knockout vector after sequencing verification.

[0046] F3: 5' ATGGTGGAGCACGACACTCTC 3'

[0047] R3: 5' TAATTCGGGGGATCTGGATTT 3'

Embodiment 2

[0048] Example 2. Construction of ent-kaurenoic acid hydroxylase gene insertion vector

[0049] The polynucleotide (Genbank Accession Number: EU722415, SEQ ID NO: 3) of ent-kaurenoic acid hydroxylase (KAH, kaurenoic acid-13hydroxylase) encoded by Stevia Rebaudiana Bertoni is derived from a plant The DNA sequence is quite different from the codon preference of Gibberella fujikuroi. In order to realize the high expression of this gene in Gibberella fujikuroi, we performed statistics on the published expression cassette sequences derived from Gibberella fujikuroi, and obtained the sequence suitable for Gibberella fujikuroi. fujikuroi) high-frequency codon table, and based on this, the polynucleotide encoding ent-kaurenoic acid hydroxylase was optimized, and finally obtained by whole gene synthesis for use in Gibberella fujikuroi ) expression. The optimized polynucleotide encoding ent-kaurenoic acid hydroxylase (SEQ ID NO: 4) was cloned under the control of the gpdA promoter in ...

Embodiment 3

[0059] Example 3. Protoplast preparation and regeneration

[0060] Inoculate Gibberella fujikuroi on PDA solid culture, culture at 27°C for 8 days, and take a sample of about 0.5 cm in size from a fresh slant 2 The bacterial lawn was ground and placed in 100ml MYG liquid medium, cultivated at 24°C and 130r / min for 24 hours, then transferred to fresh liquid medium at 1% inoculum size (v / v) and continued to cultivate for 15 hours. Mycelium with sterile water, 1M MgSO 4 Wash each once. Get about 1g of wet mycelia in 10ml of lysing enzyme solution (10ml of 1M MgSO 4 Add 200 mg of lysozyme, filter sterilized), and incubate at 37°C for 4 hours. Centrifuge the suspension at 3000rpm for 10min, discard the precipitate containing mycelium fragments, and slowly dilute the supernatant with sterile water to MgSO 4 The concentration was 0.5 M, centrifuged at 3000rpm for 15min, and the pellet (protoplast) was washed with 0.5M MgSO 4 and 1M sorbitol solution were washed once, and finally...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method utilizing gene engineering to modify enzyme to prepare terpenoid. A gene knocking technology is utilized to knock off the ent-kaurene oxidase gene of gibberellin fungus, so that the ent-kaurene oxidase cannot express in gibberellin fungus, the ent-kaurenic acid will not be converted into gibberellin A12 (GA12), and the accumulated ent-kaurenic acid can be converted into steviol. The gibberellin production technology through fungus fermentation is a mature and stable technology, the bacterial strains are all high-yield gibberellin production bacterial strains, and the provided method develops a novel route and smartly utilizes the matured gibberellin production process to produce two terpenoid compounds, which are rare in the nature, namely steviol and ent-kaurenic acid. The yield of the provided method is far more than those of methods, which have been reported at aboard, and the application value of the method is high.

Description

technical field [0001] The invention relates to a preparation method of a gibberellin precursor tetracyclic diterpene ent-kaurenoic acid and a method for preparing steviol from ent-kaurenoic acid, in particular to a genetically engineered A method for preparing diterpene ent-kaurenoic acid involving kaurenoic acid oxidase, and a method for preparing steviol from ent-kaurenoic acid. Background technique [0002] Stevioside, commonly known as stevioside, stevioside, is the extract of Stevia rebaudiana, a herb of Compositae. It is widely used in the production of food, beverage and seasoning in various countries. The sweetness of stevioside is 200-300 times that of sucrose, and the calories are only 1 / 300 of sucrose, so it can be used as a sugar substitute for plants without calories. [0003] Steviol glycosides use the diterpenoid steviol (Steviol) as the non-sugar side of the aglycone. According to the type and number of sugar groups connected by O-glycosidic bonds on the h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/09C12N15/63C12P7/42C12P7/40C12R1/645C12R1/865
Inventor 朱惠霖
Owner NANJING NUOYUN BIOLOGICAL TECH CO LTD