Vector for efficiently secreting and expressing heterogenous protein, and its application
A technology for secreting and expressing heterologous proteins is applied in the field of vectors for efficient secreting and expressing heterologous proteins, which can solve the problems of low secretion efficiency of signal peptides, and achieve the effects of improving water solubility, saving time and improving efficiency.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Construction of vector pCT7-CHISP6H for high-efficiency secretion and expression of heterologous proteins in Escherichia coli.
[0029] (1) Amplification of the signal peptide sequence of the chitosanase gene of Microbacterium sp.OU01
[0030] Using the genomic DNA of Microbacterium sp.OU01 as a template and CHISP-F / CHISP-R as a primer pair, perform PCR amplification;
[0031] Primers are:
[0032] CHISP-F: GC CATATG AAGATTCAACGACTTG (the underlined part is the Nde I restriction site)
[0033] CHISP-R: GC GAATTCGTGCAC CATCACCATCACCATGGAGGCAGCGCACCCG CT (The underlined part is the EcoR I restriction site; the double underlined part is the PmaC I restriction site; the bold part is the 6×His tag sequence)
[0034] The PCR reaction system is 20ul, as follows:
[0035]
[0036] PCR amplification program: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, a total of 30 cycles; final extension at ...
Embodiment 2
[0057] Construction of recombinant expression vector pCT7-CHISP6H-mschito of chitosanase mature peptide of Microbacterium sp.OU01, induced expression, separation and purification and activity analysis.
[0058] (1) Microbacterium sp.OU01 chitosanase mature peptide sequence amplification and fragment recovery
[0059] Combination according to the mature peptide sequence information of Microbacterium sp.OU01 chitosanase HD Clontech kit instructions, design primers to amplify its mature peptide sequence, the primer sequence is as follows:
[0060] pCT7-CHISP6H-mschitoF: CATCACCATCACCAC TCCGCCGAAACGGCCGGGA (the underlined sequence is the 15bp sequence matching the linearized vector pCT7-CHISP6H)
[0061] pCT7-CHISP6H-mschitoR: AAGCTTCGAATTCAC CTAGTTCAGGGAGAACTGG (the underlined sequence is the 15bp sequence matching the linearized vector pCT7-CHISP6H)
[0062] Using pCT7-CHISP6H-mschitoF / pCT7-CHISP6H-mschitoR as a primer pair and the genomic DNA of Microbacterium sp.OU01 as...
Embodiment 3
[0076] Construction of expression vector, recombinant expression and activity analysis of Bacillus sp.S-1 chitosanase using expression vector pCT7-CHISP6H
[0077] In order to test the universality of the signal peptide, the chitosanase of Gram-positive bacteria Bacillus sp.S-1 (registration number: EU924147) was used to test in this expression system, and the recombinant expression vector pCT7-CHISP6H-Bschito Construction method is the same as embodiment 2, and concrete operation is as follows:
[0078] The primer sequences designed to amplify the mature peptide of Bacillus sp.S-1 chitosanase are as follows:
[0079] pCT7-CHISP6H-bschitoF:
[0080] CATCACCATCACCAC GCAAGTGTAACGGACAATTC (the underlined sequence is the 15bp sequence matching the linearized vector pCT7-CHISP6H)
[0081] pCT7-CHISP6H-bschitoR:
[0082] AAGCTTCGAATTCAC TTAATTATCGTATCCTTCATAAATCGC (the underlined sequence is the 15bp sequence matching the linearized vector pCT7-CHISP6H)
[0083] Using pCT7-C...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap