Method for improving synthesis of trichodermin from trichoderma brevicompactum
A technology of Trichoderma umbilicus and Trichoderma, which is applied in the field of microbial technology and biological control, can solve problems such as long distance, and achieve the effect of increasing concentration and improving reliability.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Embodiment 1 (preparation of plasmid containing hygromycin B resistance gene fragment)
[0021] Follow these steps:
[0022] (1) Use LB medium to cultivate the host bacteria of pSilent-1 and pCAMBIA0380 plasmids under the conditions of 37 ℃ and 180 r / min. After 12 hours, use the SanPrep column plasmid DNA mini-extraction kit to extract pSilent-1 respectively and pCAMBIA0380 plasmid.
[0023] (2) Using restriction enzymes Bst X I and Xma I enzyme, carry out double enzyme digestion on the pSilent-1 and pCAMBIA0380 plasmids respectively, separate the digested products by 1% agarose gel electrophoresis, cut out the target bands, and recover the target bands using the SanPrep Column DNA Gel Recovery Kit .
[0024] (3) Use T4 DNA ligase to connect the hygromycin B resistance gene fragment (Hygr) on the pSilent-Si plasmid to the BstX I / Xma I restriction site of the pCAMBIA0380 plasmid, and the plasmid at this time is named pCAMBIA0380-H .
Embodiment 2
[0025] Embodiment 2 (Agrobacterium-mediated transformation)
[0026] Follow these steps:
[0027] (1) Transform the pCAMBIA0380-H plasmid into Agrobacterium AGL-1 competent cells in YEB medium (medium composition: sucrose 5 g / L, yeast extract 1 g / L, peptone 10 g / L, Magnesium sulfate 0.5 g / L) After culturing at 28°C for two days, pick a single colony and extract the plasmid, and use hygromycin B resistance gene verification primers H-F / H-R (H-F: GAAGAGGTAAACCCGAAACG, H-R: GGCA AACTGTGA TGGACGAC) for bacterial liquid PCR, Positive transformants were further screened, and the verified Agrobacterium positive clone was named AP03H.
[0028] (2) Co-culture the positive clone AP03H bacteria with the spore suspension of Trichoderma umbilifera 0248 to transform and integrate the hygromycin B resistance gene into the 0248 bacteria. A positive transformant (named AZ1) was obtained through screening on the potato dextrose agar plate;
[0029] (3) Use a liquid medium containing hygromyc...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap