Supercharge Your Innovation With Domain-Expert AI Agents!

Method for improving synthesis of trichodermin from trichoderma brevicompactum

A technology of Trichoderma umbilicus and Trichoderma, which is applied in the field of microbial technology and biological control, can solve problems such as long distance, and achieve the effect of increasing concentration and improving reliability.

Inactive Publication Date: 2015-02-11
CHINA JILIANG UNIV
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In order to improve the development value and market competitiveness of Trichoderma, many researchers have adopted methods such as physical mutagenesis and induction to increase the yield of Trichoderma, but at this stage, the level of Trichoderma production is far from the industrialization process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving synthesis of trichodermin from trichoderma brevicompactum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Embodiment 1 (preparation of plasmid containing hygromycin B resistance gene fragment)

[0021] Follow these steps:

[0022] (1) Use LB medium to cultivate the host bacteria of pSilent-1 and pCAMBIA0380 plasmids under the conditions of 37 ℃ and 180 r / min. After 12 hours, use the SanPrep column plasmid DNA mini-extraction kit to extract pSilent-1 respectively and pCAMBIA0380 plasmid.

[0023] (2) Using restriction enzymes Bst X I and Xma I enzyme, carry out double enzyme digestion on the pSilent-1 and pCAMBIA0380 plasmids respectively, separate the digested products by 1% agarose gel electrophoresis, cut out the target bands, and recover the target bands using the SanPrep Column DNA Gel Recovery Kit .

[0024] (3) Use T4 DNA ligase to connect the hygromycin B resistance gene fragment (Hygr) on the pSilent-Si plasmid to the BstX I / Xma I restriction site of the pCAMBIA0380 plasmid, and the plasmid at this time is named pCAMBIA0380-H .

Embodiment 2

[0025] Embodiment 2 (Agrobacterium-mediated transformation)

[0026] Follow these steps:

[0027] (1) Transform the pCAMBIA0380-H plasmid into Agrobacterium AGL-1 competent cells in YEB medium (medium composition: sucrose 5 g / L, yeast extract 1 g / L, peptone 10 g / L, Magnesium sulfate 0.5 g / L) After culturing at 28°C for two days, pick a single colony and extract the plasmid, and use hygromycin B resistance gene verification primers H-F / H-R (H-F: GAAGAGGTAAACCCGAAACG, H-R: GGCA AACTGTGA TGGACGAC) for bacterial liquid PCR, Positive transformants were further screened, and the verified Agrobacterium positive clone was named AP03H.

[0028] (2) Co-culture the positive clone AP03H bacteria with the spore suspension of Trichoderma umbilifera 0248 to transform and integrate the hygromycin B resistance gene into the 0248 bacteria. A positive transformant (named AZ1) was obtained through screening on the potato dextrose agar plate;

[0029] (3) Use a liquid medium containing hygromyc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the fields of microbial technology and biological prevention, and particularly relates to a method for improving synthesis of trichodermin from trichoderma brevicompactum 0248. The concentration of trichodermin in a fermentation liquor can be increased by obtaining hygromycin B resistant gene-containing trichoderma brevicompactum transformed strain AZ1 and adding hygromycin B into a liquid fermentation culture medium. The method provides a reliable method for improving the fermentation unit of the trichoderma brevicompactum.

Description

technical field [0001] The invention relates to the field of microbial technology and biological control, in particular to a method for improving the [0002] bacteria( Trichoderma brevicompactum ) 0248 Method for synthesizing Trichoderma. Background technique [0003] Trichodermin——a kind of trichothecene compound, this compound has different degrees of inhibitory effects on the mycelial growth and spore germination of nine common plant pathogenic fungi, and it is effective against cucumber blight and tomato Botrytis cinerea and other fungal diseases have good biocontrol effects, so they are considered to be antifungal substances with broad application prospects in biocontrol. Trichoderma is mainly produced by the Trichoderma fungus Trichoderma umbilicaleum ( T. brevicompactum ) produced by fermentation. In order to improve the development value and market competitiveness of Trichoderma, many researchers have used methods such as physical mutagenesis and induction to i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12P7/62C12N15/80C12R1/885
CPCC12N15/80C12P17/181
Inventor 申屠旭萍袁小枫俞晓平刘卫平汤谷
Owner CHINA JILIANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More