Genetically engineered bacterium for expressing beta cyclodextrin glycosyl transferase as well as construction method and use thereof

A technology of glycosyltransferase and genetically engineered bacteria, which is applied to genetically engineered bacteria expressing β-cyclodextrin glycosyltransferase and its construction field, can solve problems such as low enzyme production capacity, and achieve advanced technology, high quality, and elimination of impurities. Effects of protein and some impurities

Inactive Publication Date: 2015-02-18
HEFEI UNIV OF TECH
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The genetically engineered strains reported so far have low enzyme-producing ability. Therefore, in order to develop a β-CGTase-producing strain suitable for industrial production of β-CD, molecular biology research was carried out on β-CGTase, and engineering strains were constructed to obtain stability. Good, high-yielding, easy-to-isolate and purify recombinant β-CGTase is an important and urgent task

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetically engineered bacterium for expressing beta cyclodextrin glycosyl transferase as well as construction method and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: Construction of recombinant expression plasmid pET22-cgt

[0027] According to the β-CGTase gene sequence that has been cloned, according to the sequence characteristics of the expression vector pET22b(+), primers were designed with the help of Primer Premier 5.0 as follows:

[0028] Forward primer: 5'CGC GGATCC GATGATTACGCCAAGCTTTA3' (BamHI);

[0029] Reverse primer: 5'ACGC GTC GAC TTACCAATTTGATATGACC3' (SalI).

[0030] Using the cloned β-CGTase gene as a template, use PCR amplification technology to obtain gene clone products containing BamHI and SalI restriction sites. The PCR product recovery procedure is as follows:

[0031] 1. Take a sterilized clean centrifuge tube and weigh it.

[0032]2. Quickly cut off the gel block containing the target fragment from the agarose gel gel plate with a clean blade under the ultraviolet light, weigh and calculate the volume of the gel block.

[0033] 3. Add 3 times the volume of the glue block melting solution B...

Embodiment 2

[0039] Embodiment 2: Construction of genetically engineered bacteria BL21(DE3) / pET22cgt

[0040] Transform the recombinant expression plasmid pET22-cgt into CaCl 2 From the treated E.coli BL21(DE3), the β-CGTase engineered strain BL21(DE3) / pET22-cgt was obtained after ampicillin resistance screening and enzyme digestion verification.

[0041] Escherichia coli competent cell preparation (CaCl 2 method) as follows:

[0042] 1. Pick a newly activated single colony from the LB plate, inoculate it in 5ml~10mL LB liquid medium, and cultivate it with shaking at 37°C for about 12 hours until the late logarithmic growth period.

[0043] 2. Inoculate the bacterial suspension in step 1 into 100 mL of LB liquid medium at a ratio of 1:100 to 1:50, and incubate with shaking at 37°C for 2-3 hours until OD600=0.4 to 0.5.

[0044] 3. Take two sterilized 50mL centrifuge tubes, add 20mL of the bacterial solution obtained in step 3 to each tube, and bathe in ice for 30min; centrifuge at 4000×g...

Embodiment 3

[0058] Embodiment 3: the expression of genetically engineered bacteria β-CGTase

[0059] Inoculate the genetically engineered bacteria E.coli BL21(DE3) / pET22-cgt into the liquid LB medium containing ampicillin 100ug / mL and culture at 37°C. When the OD600 reaches 1.0, add IPTG with a final concentration of 0.5mmol / L for induction After 6 hours, the sample was taken, and the sample was subjected to SDS-PAGE electrophoresis analysis after crushing. The molecular weight of the expressed β-CGTase protein was basically consistent with the predicted value (about 68kDa).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a genetically engineered bacterium for expressing beta cyclodextrin glycosyl transferase as well as a construction method and a use thereof. The genetically engineered bacterium for expressing the beta cyclodextrin glycosyl transferase is genetically engineered bacterium E. coli BL21(DE3) / pET22-cgt obtained by transforming recombinant expression plasmid pET22-cgt which is obtained by inserting a beta cyclodextrin glycosyl transferase gene obtained by cloning into an expression vector pET22b(+) in host bacteria E.coliBL21(DE3). The genetically engineered bacterium for highly expressing beta-CGTase, constructed by the construction method disclosed by the invention, can be used for changing a culture medium of original microorganisms, separating thalli which appear in a production process of the bacteria to obtain relatively pure beta-CGTase, and directly preparing beta-CD by virtue of the beta cyclodextrin glycosyl transferase, so that the existing domestic beta-CD production process is radically improved to obtain high-quality beta-CD.

Description

1. Technical field [0001] The present invention relates to a genetically engineered bacterium and its preparation method and use, in particular to a genetically engineered bacterium expressing β-cyclodextrin glycosyltransferase and its construction method and use. 2. Background technology [0002] Cyclodextrin (Cyclodextrin, CD), also known as cyclopolyglucose, is formed by the action of cyclodextrin glycosyltransferase (CGTase) on starch. It is composed of multiple D-glucopyranose units passing through α-1,4 A class of cyclic oligosaccharides linked by glycosidic bonds. Since cyclodextrin has no reducing and non-reducing end groups, its chemical properties are quite stable. The molecular shape of cyclodextrin is a slightly cone-shaped cavity structure with "hydrophobic inside and hydrophilic outside". It is this special structure that enables it to form inclusions with many hydrophobic guest compounds or functional groups, thereby Change its physical, chemical or biologic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/70C12N9/10C12P19/18C12P19/04
CPCC12N9/1074C12N15/70C12P19/04C12P19/18C12Y204/01019
Inventor张洪斌凌凯王超胡雪芹
OwnerHEFEI UNIV OF TECH