Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Insecticidal gene sip1A secreted by bacillus thuringiensis as well as expression protein and application thereof

A technology of Bacillus thuringiensis and insecticidal protein, applied in the fields of application, insecticide, genetic engineering, etc., can solve the problems of single pests and increased resistance of pests, achieve broad application prospects, expand insecticidal spectrum, and delay drug resistance Effect

Active Publication Date: 2015-03-04
NORTHEAST AGRICULTURAL UNIVERSITY
View PDF4 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Since the current commercialized transgenic insect-resistant crops have relatively single types of insect-resistant genes, such large-scale promotion of planting has the risk of reducing pest refuges and increasing pest resistance.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Insecticidal gene sip1A secreted by bacillus thuringiensis as well as expression protein and application thereof
  • Insecticidal gene sip1A secreted by bacillus thuringiensis as well as expression protein and application thereof
  • Insecticidal gene sip1A secreted by bacillus thuringiensis as well as expression protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1, isolate and obtain Bacillus thuringiensis bacterial strain QZL38

[0037]The applicant's laboratory staff obtained a strain of Bacillus thuringiensis isolated from the soil of Qianshan Mountain in Liaoning Province. The spores of Bacillus thuringiensis are spore outer wall, spore coat, cortex, spore inner wall, protoplasmic membrane and protoplast from outside to inside. . The main component of the cortex is peptidoglycan, a polysaccharide teichoic acid that does not contain vegetative cells, which maintains the dehydration state and heat resistance of the spores. On the other hand, during the formation of the spores, a large amount of DPA-Ca will be produced. thuringiensis spores will not die after heat treatment at 80°C for 20 minutes, and the dormant spores are treated at a sub-lethal temperature of 75°C for 15 minutes, the activation effect is the best , not only promote its rapid germination, but also improve the survival rate of spores (Yu Ziniu 199...

Embodiment 2

[0054] Example 2. Obtaining new genes

[0055] 2.1 Detect strain QZL38 using sip gene universal primers, the primers are as follows

[0056] SP5 GTTGCTCTATAATATGGATTAGCAC

[0057] SP3 CTGGTAAACCAATAAATATGCAAG

[0058]

[0059] Add 50 μL of ultrapure water,

[0060] Amplification cycle: denaturation at 94°C for 1 minute, annealing at 56°C for 1 minute, extension at 72°C for 4 minutes, 25 cycles, and finally extension at 72°C for 10 minutes.

[0061] The result is as image 3 As shown, strain QZL38 was subjected to genotype PCR identification, and a PCR product with a size of 750 bp was obtained by using the sip class gene identification primer sp5 / sp3.

[0062] 2.1 Cloning of sip1A gene in QZL38 strain

[0063] The new sip1A gene in the strain was isolated and cloned by rapid cloning method.

[0064] Referring to the 5' and 3' sequences of the gene coding region of sip1A published in GenBank, the primer sequences are as follows:

[0065] Upstream primer Sip5: 5′-ATGAA...

Embodiment 3

[0088] Embodiment 3, gene expression and activity assay

[0089] 3.1.1 Plasmid DNA was extracted from the above clones, and transformed into the recipient strain Rosetta (DE3) to obtain an expression strain.

[0090] After IPTG induced expression, SDS-PAGE protein electrophoresis was performed.

[0091] The process of inducing expression is as follows:

[0092] 1) Activated strains (37°C, 12hr);

[0093] 2) 10% inoculated in LB medium (37°C, 2hr);

[0094] 3) Add the inducer IPTG, 150rpm, and induce at 18-22°C for 4-20h at low temperature;

[0095] 4) The cells were collected by centrifugation, and 10 mM Tris Cl (pH 8.0) was added to suspend;

[0096] 5) Broken bacteria (ultrasonic crushing is complete);

[0097] Centrifuge at 12,000rpm for 10min at 4°C;

[0098] Collect 10-15 μL each of the supernatant and the precipitate, and detect them by electrophoresis.

[0099] The polyacrylamide gel configuration is as follows.

[0100]

[0101]Sample loading: 10-15μl sample...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a 'bacillus thuringiensis sip1A gene as well as an expression protein and application thereof' and belongs to the technical field of biological prevention and control. An insecticidal protein has amino acid sequences as shown in SEQ ID NO. 2 and a gene used for encoding the insecticidal protein has nucleotide sequences preferably as shown in SEQ ID NO. 1. The gene has high virulence to coleopteran pests and is applied in transforming microorganisms and plants so that the microorganisms and plants exhibit toxicity to relevant pests and the generation of insecticide resistance of pests to engineered bacteria and transgenic plants is overcome and delayed.

Description

technical field [0001] The invention relates to the technical field of biological control, in particular to a Bt secreted insecticidal gene with high toxicity to coleopteran agricultural pests and a protein encoded by the gene. Background technique [0002] Bacillus thuringiensis (Bt) is a widely distributed Gram-positive bacterium, an entomopathogenic microorganism with strong toxicity to pests and no toxicity to natural enemies, and no toxicity to higher animals and humans. It is currently the most in-depth study and the most widely used microbial insecticide, and it is active against more than 3000 kinds of pests in 16 orders. Bt can form insecticidal crystal proteins (Insecticidal Crystal Proteins, ICPs), also known as δ-endotoxin (delta-endotoxin) during the sporulation stage, its shape, structure and size are closely related to its virulence [Schnepf.E, Crickmore .N,Van Rie.J.,Lereclus.D,Baum.J,Feitelson.J,Zeigler.D.R.,Dean.D.H.Bacillus thuringiensis and its pesticida...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20A01N63/00A01N47/44A01P7/04C07K14/325C12N15/32C12N15/70C12N1/21C12R1/07
CPCA01N47/44A01N63/00C07K14/325C12N1/205C12R2001/075
Inventor 李海涛高继国刘荣梅张金波张杰
Owner NORTHEAST AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products