Insecticidal gene sip1A secreted by bacillus thuringiensis as well as expression protein and application thereof
A technology of Bacillus thuringiensis and insecticidal protein, applied in the fields of application, insecticide, genetic engineering, etc., can solve the problems of single pests and increased resistance of pests, achieve broad application prospects, expand insecticidal spectrum, and delay drug resistance Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Embodiment 1, isolate and obtain Bacillus thuringiensis bacterial strain QZL38
[0037]The applicant's laboratory staff obtained a strain of Bacillus thuringiensis isolated from the soil of Qianshan Mountain in Liaoning Province. The spores of Bacillus thuringiensis are spore outer wall, spore coat, cortex, spore inner wall, protoplasmic membrane and protoplast from outside to inside. . The main component of the cortex is peptidoglycan, a polysaccharide teichoic acid that does not contain vegetative cells, which maintains the dehydration state and heat resistance of the spores. On the other hand, during the formation of the spores, a large amount of DPA-Ca will be produced. thuringiensis spores will not die after heat treatment at 80°C for 20 minutes, and the dormant spores are treated at a sub-lethal temperature of 75°C for 15 minutes, the activation effect is the best , not only promote its rapid germination, but also improve the survival rate of spores (Yu Ziniu 199...
Embodiment 2
[0054] Example 2. Obtaining new genes
[0055] 2.1 Detect strain QZL38 using sip gene universal primers, the primers are as follows
[0056] SP5 GTTGCTCTATAATATGGATTAGCAC
[0057] SP3 CTGGTAAACCAATAAATATGCAAG
[0058]
[0059] Add 50 μL of ultrapure water,
[0060] Amplification cycle: denaturation at 94°C for 1 minute, annealing at 56°C for 1 minute, extension at 72°C for 4 minutes, 25 cycles, and finally extension at 72°C for 10 minutes.
[0061] The result is as image 3 As shown, strain QZL38 was subjected to genotype PCR identification, and a PCR product with a size of 750 bp was obtained by using the sip class gene identification primer sp5 / sp3.
[0062] 2.1 Cloning of sip1A gene in QZL38 strain
[0063] The new sip1A gene in the strain was isolated and cloned by rapid cloning method.
[0064] Referring to the 5' and 3' sequences of the gene coding region of sip1A published in GenBank, the primer sequences are as follows:
[0065] Upstream primer Sip5: 5′-ATGAA...
Embodiment 3
[0088] Embodiment 3, gene expression and activity assay
[0089] 3.1.1 Plasmid DNA was extracted from the above clones, and transformed into the recipient strain Rosetta (DE3) to obtain an expression strain.
[0090] After IPTG induced expression, SDS-PAGE protein electrophoresis was performed.
[0091] The process of inducing expression is as follows:
[0092] 1) Activated strains (37°C, 12hr);
[0093] 2) 10% inoculated in LB medium (37°C, 2hr);
[0094] 3) Add the inducer IPTG, 150rpm, and induce at 18-22°C for 4-20h at low temperature;
[0095] 4) The cells were collected by centrifugation, and 10 mM Tris Cl (pH 8.0) was added to suspend;
[0096] 5) Broken bacteria (ultrasonic crushing is complete);
[0097] Centrifuge at 12,000rpm for 10min at 4°C;
[0098] Collect 10-15 μL each of the supernatant and the precipitate, and detect them by electrophoresis.
[0099] The polyacrylamide gel configuration is as follows.
[0100]
[0101]Sample loading: 10-15μl sample...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 