Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fluorescent PCR detection kit for detecting treponema pallidum

A detection kit and Treponema pallidum technology, applied in the field of Treponema pallidum fluorescent PCR detection kit, can solve the problems of low TP-DNA detection sensitivity, DNA loss, DNA loss, etc., and achieve high detection sensitivity, wide detection range, and monitoring The effect of false negatives

Inactive Publication Date: 2015-04-29
SANSURE BIOTECH INC
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the nucleic acid extraction process is complicated, the sample processing takes a long time, and the DNA in the sample is lost through multiple steps such as boiling and lysis, high-speed centrifugation and DNA enrichment, especially for high-concentration samples. Sufficient and incomplete enrichment will cause a large loss of DNA and lead to low sample quantification; at the same time, due to the high temperature heating step of water bath or metal bath, it is easy to cause aerosol pollution
In addition, the selection of primers and probe sequences for the quantitative detection of TP-DNA by fluorescent quantitative PCR technology in these kits will also affect the specificity and sensitivity of the final detection
[0008] Because of the defects of nucleic acid extraction and nucleic acid amplification detection steps in the prior art, the detection sensitivity of TP-DNA in the prior art is not high, about 500-1000 copies / ml

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent PCR detection kit for detecting treponema pallidum
  • Fluorescent PCR detection kit for detecting treponema pallidum
  • Fluorescent PCR detection kit for detecting treponema pallidum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] This embodiment provides a fluorescent quantitative PCR detection kit for Treponema pallidum according to the present invention. The kit includes the following individually packaged components:

[0025] ① Nucleic acid release agent: 0.01-0.5mmol / L of surfactin, 50-200mmol / L of potassium chloride (KCl), 0.01%-2% of sodium dodecylsulfonate (SDS) (mass percentage ), ethanol 0.05% to 1% (volume percentage);

[0026] ②Internal standard (positive internal control): a recombinant of a 97-base-pair artificially synthesized DNA sequence inserted into the pUC18T vector, that is, a plasmid, with a concentration of 1.00E+05copies / ml~1.00E+06copies / ml, used as Positive internal control in the PCR amplification system to prevent false negatives caused by possible PCR interference substances in the sample; the sequence of 97 base pairs is: 5'-TAGGCAGTTCCCACGGACCCTTAGACGGCATTTATTTAACGTACGAAGAAACATGTCCCCCTTGTGGCTATTATTCAAAGTGGAGAAACAGGGATCGA-3';

[0027]③PCR reaction solution: includi...

Embodiment 2

[0034] The operation steps of using the Treponema pallidum nucleic acid detection kit provided in Example 1 to detect TP-DNA in unknown samples such as exudate from skin damage, genital tract secretions, etc. are:

[0035] 1 Reagent preparation:

[0036] According to the number of samples to be tested, negative control, positive control and quantitative reference products A~D, proportionally (PCR reaction solution 38~44μl / person + enzyme mixture 1~2μl / person+internal standard 0.25μl / person) Take the corresponding amount of PCR reaction solution, enzyme mixture and internal standard, mix thoroughly to form a PCR-mix, centrifuge briefly and set aside.

[0037] 2 sample processing

[0038] 1) Add 2-5 μl of nucleic acid release agent to each PCR reaction tube (deep suction and shallow pipetting are recommended to avoid air bubbles), and add 3-5 μl each of the sample to be tested, negative control, positive control and quantitative reference in sequence;

[0039] 2) At an interva...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a fluorescent PCR detection kit for detecting treponema pallidum. The kit comprises a nucleic acid releasing agent and a PCR reaction solution containing sequences of a primer and a probe which are used for detecting target nucleotide, wherein the nucleic acid releasing agent comprises 0.01-0.5mmol / L of surfactin, 50-200mmol / L of potassium chloride and 0.01%-2% by mass of sodium dodecyl sulfate and 0.05%-1% by volume of ethanol; the sequence of the primer for detecting target nucleotide comprises: an upstream primer: 5'-GACTGACCCAAGCGTTACTAAGATG-3', a downstream primer: 5'-CCCTCGACTGCTTCAAACTTAATC-3', and the sequence of the probe is 5'-CCCCGTCCTCTCCCAAATCCTGA-3'. When the fluorescent PCR detection kit for detecting treponema pallidum, which is provided by the invention, is used for detecting unknown samples such as skin lesion exudates and genital tract secretions, the operation is rapid, the method is simple, the detection sensitivity is high and the detection range is wide.

Description

technical field [0001] The invention relates to the field of fluorescent PCR detection kits, in particular to the fluorescent PCR detection kit of Treponema pallidum. Background technique [0002] Treponema pallidum (TP) is a pathogen that causes syphilis, which can be transmitted through blood. In recent years, the incidence has been increasing year by year. According to its transmission route, it can be divided into acquired syphilis and congenital syphilis. Acquired syphilis can be divided into primary and secondary early syphilis and tertiary late syphilis according to its course of disease and clinical manifestations. Choosing a good detection method is beneficial to the diagnosis and treatment of early syphilis. The diagnosis of early syphilis is worthy of attention, because some cases have atypical clinical symptoms, the antibody appears late, and the specificity and sensitivity of conventional laboratory detection methods are low, which will inevitably lead to misse...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04
CPCC12Q1/689C12Q2600/112
Inventor 戴立忠邓中平张操昊刘佳
Owner SANSURE BIOTECH INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products