Fluorescent PCR detection kit for detecting treponema pallidum
A detection kit and Treponema pallidum technology, applied in the field of Treponema pallidum fluorescent PCR detection kit, can solve the problems of low TP-DNA detection sensitivity, DNA loss, DNA loss, etc., and achieve high detection sensitivity, wide detection range, and monitoring The effect of false negatives
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] This embodiment provides a fluorescent quantitative PCR detection kit for Treponema pallidum according to the present invention. The kit includes the following individually packaged components:
[0025] ① Nucleic acid release agent: 0.01-0.5mmol / L of surfactin, 50-200mmol / L of potassium chloride (KCl), 0.01%-2% of sodium dodecylsulfonate (SDS) (mass percentage ), ethanol 0.05% to 1% (volume percentage);
[0026] ②Internal standard (positive internal control): a recombinant of a 97-base-pair artificially synthesized DNA sequence inserted into the pUC18T vector, that is, a plasmid, with a concentration of 1.00E+05copies / ml~1.00E+06copies / ml, used as Positive internal control in the PCR amplification system to prevent false negatives caused by possible PCR interference substances in the sample; the sequence of 97 base pairs is: 5'-TAGGCAGTTCCCACGGACCCTTAGACGGCATTTATTTAACGTACGAAGAAACATGTCCCCCTTGTGGCTATTATTCAAAGTGGAGAAACAGGGATCGA-3';
[0027]③PCR reaction solution: includi...
Embodiment 2
[0034] The operation steps of using the Treponema pallidum nucleic acid detection kit provided in Example 1 to detect TP-DNA in unknown samples such as exudate from skin damage, genital tract secretions, etc. are:
[0035] 1 Reagent preparation:
[0036] According to the number of samples to be tested, negative control, positive control and quantitative reference products A~D, proportionally (PCR reaction solution 38~44μl / person + enzyme mixture 1~2μl / person+internal standard 0.25μl / person) Take the corresponding amount of PCR reaction solution, enzyme mixture and internal standard, mix thoroughly to form a PCR-mix, centrifuge briefly and set aside.
[0037] 2 sample processing
[0038] 1) Add 2-5 μl of nucleic acid release agent to each PCR reaction tube (deep suction and shallow pipetting are recommended to avoid air bubbles), and add 3-5 μl each of the sample to be tested, negative control, positive control and quantitative reference in sequence;
[0039] 2) At an interva...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com