Method for screening and detecting single-nucleotide polymorphic site G642A of marsupenaeus japonicus

A single nucleotide polymorphism, G642A technology, applied in the field of screening and detection of the G642A single nucleotide polymorphism site of Penaeus japonicus, can solve the problems of high cost and inability to directly apply the marker, and achieve simple and fast operation , The effect of low cost of screening and testing

Inactive Publication Date: 2015-05-13
XIAMEN UNIV
View PDF3 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the family Penaeidae, Yang Yu et al. and Matthew Baranski et al. reported Litopenaeus vannamei (Yu Y, Wei J, Zhang X, et al. SNP Discovery in the Transcriptome of White Pacific Shrimp Litopenaeus vannamei by Next Generation Sequencing[J].PloS one,2014,9(1):e87218) and Penaeus monodon (Baranski M, Gopikrishna G, Robinson N A, et al.The Development of a High Density Linkage Map for Black Tiger Shrimp(Penaeus monodon)Based on cSNPs[J].PloS one,2014,9(1):e85413) SNP marker screening, the detection and typing methods used are re-sequencing typing and gene chip typing, marker The cost of screening, verification and application is high, and due to the different types of prawns, the markers screened by the two scholars cannot be directly applied to the related research of Penaeus japonicus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for screening and detecting single-nucleotide polymorphic site G642A of marsupenaeus japonicus
  • Method for screening and detecting single-nucleotide polymorphic site G642A of marsupenaeus japonicus
  • Method for screening and detecting single-nucleotide polymorphic site G642A of marsupenaeus japonicus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] 1. Use bioinformatics analysis to obtain spliced ​​sequences containing candidate single nucleotide polymorphic sites. The specific process is as follows: First, perform transcriptome sequencing of the hepatopancreas of the mixed sample Penaeus japonicus, and use trinity software to splice according to the default parameters Hepatopancreas reference transcripts, use BWA software to align transcriptome sequencing reads (reads) to reference transcripts according to the default parameters, use GATK software to screen for alignment quality scores greater than 40, minor allele frequency above 200, minor allele frequency If the locus with an allele frequency higher than 20% is a candidate locus, the comp11169 splice sequence is screened for primer design, and its sequence is:

[0026] GATGTCGTATTAATGTCTTTATCCAATTAAAAAATCATCATTTATAATTCTAAGCATCTGACGACTATAATATGTAGGTATAACATTGTACTTATACATGGAGAGTCGAAATCTTGAATCATTTAACCTGTTCCTACAATATCACAAGAGACAAGTAATTGAACCAATCACAATCACAAAAGTAAAGGAAAGAAA...

Embodiment 2

[0034] 1. According to the screening of comp11169 splicing sequence in Example 1, design sequencing primers for G642A_SNP site verification and typing.

[0035] 2. The PCR product amplified by the designed sequencing primers should include the single nucleotide polymorphism G642A_SNP site, and the primer sequence is:

[0036] Positive strand primer three: 5'-CGTGCCCTTGTAGATGCA-3';

[0037] Negative strand primer: 5'-TTCGTCGAGAGAACCACT-3'.

[0038] 3. Use the sequencing primers designed in step 2 to perform PCR amplification on the 24 individuals in Example 1. The PCR reaction system is 30 μL, including 1 μL of 50 ng / μL Genomic DNA Solution of Penaeus japonicus, 3 μL of 10×PCR buffer, 2.5 mM dNTP Mixes 2.4 μL, 25 mM MgCl 2 4 μL, 0.15 μL of 5U / μL Taq DNA polymerase, 0.5 μL of 10 uM forward-strand primer and 0.5 μL of reverse-strand primer, add ddH2O to 30 μL; PCR reaction program: denaturation at 94°C for 10 min; 94°C for 30 sec, 60°C for 30 sec, 72°C for 30 sec , 40 cycles;...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for screening and detecting a single-nucleotide polymorphic site G642A of marsupenaeus japonicus, and relates to the marsupenaeus japonicas. A specific primer is designed by a PAMSA method, so that verification and genotyping of a single-nucleotide polymorphic mark of the marsupenaeus japonicas can be conveniently and quickly performed through polyacrylamide gel electrophoresis; the method has the advantages of low screening and detecting expense, high simplicity, convenience and quickness in operation and the like; by the method, parentage determination of the marsupenaeus japonicas, establishment of a genetic linkage map, and other researches are facilitated; under the condition that information of the single-nucleotide polymorphic site of a genome DNA of the marsupenaeus japonicas is unknown, through transcriptome mixed sample sequencing, and by virtue of bioinformatic analysis, the single-nucleotide polymorphic site G642A is screened; the specific primer is designed by the PAMSA method, so that the single-nucleotide polymorphic site G642A of the marsupenaeus japonicas can be conveniently and quickly detected, verified and genotyped through the polyacrylamide gel electrophoresis, the screening and detecting expense is low and the operation is simple, convenient and quick.

Description

technical field [0001] The invention relates to Penaeus japonicus, in particular to a method for screening and detecting the G642A single nucleotide polymorphism site of Penaeus japonicus. Background technique [0002] Japanese sac shrimp (Marsupenaeus japonicus) is distributed in India and the Western Pacific region, and is mainly distributed in the coastal waters south of the Yangtze River Estuary in my country. Its meat is tender and delicious, it can be transported live, and its sales price is high. It is one of the main cultured shrimps in my country. At present, the seedlings of Penaeus japonicus used for breeding in my country are basically offspring of unselected sea-caught wild broodstock. The growth speed and disease resistance of the seedlings are uneven, and farmers often fail to breed due to seed quality problems. . The selection and breeding of Penaeus japonicus species is conducive to the sustainable and healthy development of its industry. Because of the sp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6827C12Q1/6888C12Q2600/156
Inventor钟声平毛勇王军苏永全
OwnerXIAMEN UNIV