Sweet wormwood AaGTD1 gene as well as coded protein and application thereof

A kind of gene coding, Artemisia annua technology, applied in the application, genetic engineering, plant genetic improvement and other directions, can solve the problem that there is no report on the AaGTD1 gene protein of Artemisia annua

Active Publication Date: 2015-05-27
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] After searching the literature of the prior art, it is found that there is no report on the AaGTD1 gene and its encoded protein of Artemisia annua

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sweet wormwood AaGTD1 gene as well as coded protein and application thereof
  • Sweet wormwood AaGTD1 gene as well as coded protein and application thereof
  • Sweet wormwood AaGTD1 gene as well as coded protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1: Cloning of Artemisia annua AaGTD1 gene

[0044] 1. Extraction of Total RNA from Artemisia annua Genome

[0045] Take an appropriate amount of fresh Artemisia annua leaves and quickly grind them into powder in liquid nitrogen, then take about 100mg of the powder and add it to a 1.5ml EP tube pre-filled with plant tissue lysate, shake and mix well, and then extract total plant RNA according to TIANGEN RNAprep Pure The kit's instructions were used to extract total RNA from Artemisia annua. The quality of RNA was identified by formaldehyde denaturing gel electrophoresis, and then the RNA concentration was determined on a spectrophotometer.

[0046] 2. Cloning of the AaGTD1 gene of Artemisia annua

[0047] Using the extracted total RNA as a template, cDNA of Artemisia annua was synthesized using the Full-Form Gold TansScript First-Strand cDNA Synthesis Supermix kit.

[0048] Gene-specific primers were designed according to the sequence of the AaGTD1 gene:

[0...

Embodiment 2

[0053] Example 2: Spatiotemporal expression analysis of Artemisia annua AaGTD1 gene

[0054] 1. Material preparation

[0055] According to the extraction method of total RNA used in Example 1, different parts of Artemisia annua were extracted, including: roots, stems, old leaves, young leaves, early flower buds, flower buds before flowering, total RNA of flowers in full flowering stage, and reversed cDNA to obtain materials for spatial expression analysis; at the same time, according to the above method, obtain RNA and cDNA from leaves of different parts of Artemisia annua growing to a height of 45-55 cm, and obtain materials for AaGTD1 gene expression analysis in leaves of different developmental stages (such as figure 2 shown).

[0056] 2. Real-time fluorescent quantitative PCR analysis

[0057] Quantitative PCR primers (Table 1) across introns of AaGTD1 gene and Actin internal reference gene were designed by primer 5, and real-time fluorescent quantitative PCR analysis w...

Embodiment 3

[0061] Example 3: Analysis of subcellular localization of Artemisia annua AaGTD1 gene

[0062] According to the content of the bioinformatics analysis in Example 1, the AaGTD1 gene is an AP2 / ERF type transcription factor with an AP2 domain. In order to further verify the nature of AaGTD1 gene transcription factor, we constructed the subcellular localization vector of AaGTD1 gene, and confirmed that AaGTD1 is localized in the nucleus by transforming rice protoplasts, which conforms to the characteristics of AaGTD1 gene transcription factor.

[0063] 1. Construction of subcellular localization vector

[0064] In this embodiment, the forward primer is designed as subGTD-F:aaCCATGGGA atgggtcaaaagaagtttag (SEQ ID NO:9), containing NCO I restriction site, and the reverse primer is subGTD-R:aa ACTAGTATTCGTATTAAGCAATTCTT (SEQ ID NO:10) , containing the Spe I restriction site. Perform PCR, enzyme digestion and ligation to finally obtain the AaGTD1 gene subcellular localization vector...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to the biological technical field, particularly an AaGTD1 gene for controlling artemisinin synthesis and trichome development in sweet wormwood as well as a coded protein and application thereof in preparing the artemisinin. The invention provides the sweet wormwood AaGTD1 gene with a nucleotide sequence as shown in SEQ ID NO:1; an amino acid sequence of protein AP2 / ERF transcription factors coded by the gene is as shown in SEQ ID NO:2. The application disclosed by the invention refers to a method for increasing the content of artemisinin in the sweet wormwood through AaGTD1. The method comprises the following steps: transforming a plant expression vector comprising the gene as shown in SEQ ID NO:1 into a sweet wormwood cell; culturing the transformed sweet wormwood cell to obtain a sweet wormwood plant with increased artemisinin content. The protein coded by the AaGTD1 gene can be used for increasing the content of artemisinin, and is of great significance for providing high-yield and stable plant materials for large-scale production of the artemisinin.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to an AaGTD1 gene and its encoded protein in Artemisia annua controlling the synthesis of artemisinin and the development of glandular hairs and its application in the preparation of artemisinin. Background technique [0002] Malaria is a global disease that threatens the health of approximately half of the world's population. In 2010 there were approximately 219 million malaria cases and 660 000 deaths. According to the WHO report in 2013, 99 countries and regions have persistent malaria transmission. Non-immune travelers from malaria-free areas become particularly ill after infection. The best available treatment for malaria, especially P. falciparum, is an artemisinin-based combination therapy. Artemisinin is a sesquiterpene lactone peroxide synthesized from the glandular hairs of the medicinal plant Artemisia annua in my country, and Artemisia annua is the only natural source of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00
Inventor张磊谭何新肖玲
OwnerSECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY