Method for quickly identifying purity of new watermelon species namely red peace hybrid seeds as well as primer and kit adopted by method
A technology for the purity and identification method of hybrid species, which is applied in the field of rapid detection of the hybrid seed purity of the new watermelon variety 'Red Peace', primers and kits, can solve the problems of long identification time and large seasonal restrictions, and avoid errors, The effect of high accuracy and simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Example 1 SSR primers used for the purity identification and development of seeds of a new watermelon variety 'Hongping':
[0034]First, download the full sequence according to the published genome sequence of new watermelon varieties (www.icugi.org / ). Subsequently, using the Mreps 2.5 SSR sequence identification program, the SSR-containing sequence segment on the DNA sequence was identified. 200 pairs of PCR primers spanning SSR loci were designed and handed over to Nanjing GenScript Company for synthesis. The actin gene of a new watermelon variety (Cla008455) is shown in SEQ ID NO:1.
Embodiment 2
[0035] Example 2 Extraction of Genomic DNA of Kernel of New Watermelon Variety
[0036] The steps of the present invention are as follows:
[0037] (1) Take a 1.5ml centrifuge tube and add 200 μl of freshly prepared SDS extraction buffer (0.5M NaCl, 0.1M Tris.HCl, 0.05M Na.EDTA, 12% SDS);
[0038] (2) Take 1 seed, remove the seed shell with tweezers, put the seed kernel into the centrifuge tube mentioned above, grind the glass rod until it becomes a paste, and then wash the glass rod with 600 μl extraction buffer;
[0039] (3) After mixing by inversion, bathe in water at 65°C for 15 minutes, mix once every 5 minutes during this period, and centrifuge briefly after the end of the water bath;
[0040] (4) Add 500 μl of chloroform:isoamyl alcohol (24:1) mixture, invert and mix well, centrifuge at 12,000 rpm for 5 minutes, transfer 600 μl of supernatant into a new 1.5ml centrifuge tube;
[0041] (5) Add 500 μl of chloroform, invert and mix well, centrifuge at 12,000 rpm for 5 mi...
Embodiment 3
[0046] Example 3 PCR Detection of Genomic DNA of New 'Red Peace' Watermelon Variety
[0047] Primers were designed using the endogenous gene ACTIN of a new watermelon variety as a template. The primer sequence was: W-actinF: 5'>AATGTGCCTGCTATGTATGTCGGATGGAGTTGTAGGTAGTTTCG2+ , TaqDNA polymerase), sterilized double-distilled water was added to 25 μl, and a blank control experiment was set up (use sterile water instead of genomic DNA). After mixing, place on a PCR reaction instrument for amplification. PCR reaction program: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 60 s, a total of 40 cycles; final extension at 72°C for 7 min; storage at 4°C. Take 8 μl of amplified product and add 2 μl of sample buffer (Takara Company) to detect by electrophoresis on 1% agarose gel, stain with EB, and image and record with a gel imaging system.
[0048] Result: if figure 2 As shown, all five samples achieved effective a...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
