Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for quickly identifying purity of new watermelon species namely red peace hybrid seeds as well as primer and kit adopted by method

A technology for the purity and identification method of hybrid species, which is applied in the field of rapid detection of the hybrid seed purity of the new watermelon variety 'Red Peace', primers and kits, can solve the problems of long identification time and large seasonal restrictions, and avoid errors, The effect of high accuracy and simple operation

Inactive Publication Date: 2015-06-17
ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF0 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The present invention is aimed at the current watermelon new variety seed purity identification mostly by field phenotype observation method, there are large seasonal restrictions, long identification time and other defects, the first purpose of the present invention is to provide a season-independent, fast A method for detecting the purity of seeds of a new watermelon variety "Red Peace" accurately and at low cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for quickly identifying purity of new watermelon species namely red peace hybrid seeds as well as primer and kit adopted by method
  • Method for quickly identifying purity of new watermelon species namely red peace hybrid seeds as well as primer and kit adopted by method
  • Method for quickly identifying purity of new watermelon species namely red peace hybrid seeds as well as primer and kit adopted by method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 SSR primers used for the purity identification and development of seeds of a new watermelon variety 'Hongping':

[0034]First, download the full sequence according to the published genome sequence of new watermelon varieties (www.icugi.org / ). Subsequently, using the Mreps 2.5 SSR sequence identification program, the SSR-containing sequence segment on the DNA sequence was identified. 200 pairs of PCR primers spanning SSR loci were designed and handed over to Nanjing GenScript Company for synthesis. The actin gene of a new watermelon variety (Cla008455) is shown in SEQ ID NO:1.

Embodiment 2

[0035] Example 2 Extraction of Genomic DNA of Kernel of New Watermelon Variety

[0036] The steps of the present invention are as follows:

[0037] (1) Take a 1.5ml centrifuge tube and add 200 μl of freshly prepared SDS extraction buffer (0.5M NaCl, 0.1M Tris.HCl, 0.05M Na.EDTA, 12% SDS);

[0038] (2) Take 1 seed, remove the seed shell with tweezers, put the seed kernel into the centrifuge tube mentioned above, grind the glass rod until it becomes a paste, and then wash the glass rod with 600 μl extraction buffer;

[0039] (3) After mixing by inversion, bathe in water at 65°C for 15 minutes, mix once every 5 minutes during this period, and centrifuge briefly after the end of the water bath;

[0040] (4) Add 500 μl of chloroform:isoamyl alcohol (24:1) mixture, invert and mix well, centrifuge at 12,000 rpm for 5 minutes, transfer 600 μl of supernatant into a new 1.5ml centrifuge tube;

[0041] (5) Add 500 μl of chloroform, invert and mix well, centrifuge at 12,000 rpm for 5 mi...

Embodiment 3

[0046] Example 3 PCR Detection of Genomic DNA of New 'Red Peace' Watermelon Variety

[0047] Primers were designed using the endogenous gene ACTIN of a new watermelon variety as a template. The primer sequence was: W-actinF: 5'>AATGTGCCTGCTATGTATGTCGGATGGAGTTGTAGGTAGTTTCG2+ , TaqDNA polymerase), sterilized double-distilled water was added to 25 μl, and a blank control experiment was set up (use sterile water instead of genomic DNA). After mixing, place on a PCR reaction instrument for amplification. PCR reaction program: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 60 s, a total of 40 cycles; final extension at 72°C for 7 min; storage at 4°C. Take 8 μl of amplified product and add 2 μl of sample buffer (Takara Company) to detect by electrophoresis on 1% agarose gel, stain with EB, and image and record with a gel imaging system.

[0048] Result: if figure 2 As shown, all five samples achieved effective a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biotechnology, and in particular relates to a method for quickly identifying the purity of watermelon 'red peace' hybrid seeds as well as a primer and a kit adopted by the method. The method for identifying the purity of the watermelon 'red peace' seeds comprises the following steps: 1, performing SSR primer development according to an announced watermelon genome sequence; 2, taking a single watermelon kernel to perform genome DNA extraction; 3, performing PCR (polymerase chain reaction) amplification and electrophoresis on a parent and a first-filial generation by using the developed SSR primer to obtain primers with differences and relative positions on a gel, and manufacturing a standard map of the 'red peace' species; and 4, identifying the purity of a to-be-tested sample seed. Compared with the traditional field identification (which needs 80-100 days), the method provided by the invention only needs 1-2 days, has the advantages of no dependence on seasons, fastness, accuracy, low cost and the like, and can replace the traditional method for identifying watermelon hybrid seeds. The method provided by the invention can be popularized and applied to seed preparation, seed reproduction and distribution enterprises of the 'red peace'.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for rapidly detecting the purity of hybrid seeds of a new watermelon variety 'Red Peace', as well as primers and a kit used. Background technique [0002] A new watermelon variety【Citrullus lanatus(Thunb.) Matsum.&Nakai】is an important economic crop. The annual planting area of ​​new watermelon varieties in my country is about 1.73×10 6 hm 2 , with a total output of about 6.28×10 7 t, the area and output accounted for more than 54% and 60% of the world respectively, ranking first in the world. Therefore, the seed purity of new watermelon varieties is a must for growers. [0003] In the process of seed production of new hybrid varieties of watermelon, the female parent and the male parent are planted in different areas, and all the male flowers on the female parent are removed before the female flower blooms. During the flowering period, the pollen of the mal...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q2600/156
Inventor 牛晓伟范敏赵小强
Owner ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com