Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction and application of shuttle vector between Escherichia coli and Lactobacilli

A technology of Escherichia coli and shuttle vector, applied in the field of microbial genetic engineering, can solve the problems of great impact on human health, teratogenicity, food poisoning, etc., and achieve a wide range of effects.

Inactive Publication Date: 2015-06-24
BEIJING UNIV OF AGRI
View PDF5 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have shown that some chemical preservatives are carcinogenic, teratogenic and cause food poisoning, which have a greater impact on human health, and their application is increasingly restricted by many countries

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and application of shuttle vector between Escherichia coli and Lactobacilli
  • Construction and application of shuttle vector between Escherichia coli and Lactobacilli
  • Construction and application of shuttle vector between Escherichia coli and Lactobacilli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1, Extraction and Identification of Lactobacillus plantarum Zhang-LL Endogenous Plasmid

[0034] 1. Extraction of Lactobacillus plantarum Zhang-LL endogenous plasmid

[0035] A single colony of Lactobacillus plantarum Zhang-LL was picked, inoculated in 5 mL of MRS medium, and cultured at 37°C for 16 hours. Centrifuge the bacterial solution at 5,000rpm for 5min, discard the supernatant, resuspend the bacterial solution in 250μl buffer I (20mg / mL lysozyme, 50mM glucose, 25mM Tris-Cl, 10mM EDTA, pH 8.0), and place at 37°C for 1h , add 250 μl of buffer II (0.2N NaOH, 1% SDS), mix well, leave at room temperature for 5 minutes, add 350 μl of buffer III (3M potassium acetate, 2M acetic acid), mix well, and leave at room temperature for 10 minutes. Centrifuge at 12,000 rpm for 10 min, pipette 700 μl of the supernatant into a new centrifuge tube, add 700 μl of phenol:chloroform:isoamyl alcohol (25:24:1) solution, shake vigorously and mix well. Centrifuge at 12,000 rpm ...

Embodiment 2

[0038] Embodiment 2, construction of Escherichia coli and Lactobacillus shuttle vector pZLT3

[0039] The construction process of the shuttle vector pZLT3 is shown in the attached figure 2 Shown:

[0040] 1. Double digestion of pZL3 plasmid

[0041] Plasmid pZL3 uses KpnI (NEB Company) and NcoI (NEB Company) for double enzyme digestion reaction, the system is as follows:

[0042] 10*Buffer 2μl KpnI 1μl NCOI 1μl pZL3 plasmid 5μl Deionized water 11μl

[0043] React at 37°C for 1 hour, and react at 65°C for 5 minutes to terminate the reaction.

[0044] 2. PCR amplification of E. coli replicon

[0045] Using the prokaryotic expression vector pET30a(+) as a template, the E. coli replicon and the kanamycin resistance cassette were amplified. The upstream primer sequence: 5'AGGTACCCCCCAGTCAC 3', the downstream primer sequence: 5'CCATGGCGCTCATGAATTAATT 3', and the reaction conditions were as follows:

[0046] 10*Buffer 2.5μ...

Embodiment 3

[0057] Example 3, the application of Escherichia coli and Lactobacillus shuttle vector pZLT3 expressing lactobacillus

[0058] 1. Escherichia coli-Lactobacillus shuttle vector pZLT3 transformed into Lactobacillus casei KL1

[0059] The constructed Escherichia coli-Lactobacillus shuttle vector pZLT3 is transformed into Lactobacillus casei (Lactobacillus casei) KL1 (CGMCC No.1809), and the method steps are as follows:

[0060] (1) Pick a single colony of Lactobacillus casei KL1 freshly cultivated, inoculate it in 5 mL MRS liquid medium, and culture it statically at 37° C. for 12 hours.

[0061] (2) Inoculate into MRS culture medium at a ratio of 1:20, and continue to cultivate at 37°C until the OD600 is about 0.6; transfer the culture medium to a pre-cooled 500mL centrifuge tube, place on ice for 10min; 4°C, 5,000r / m Centrifuge for 5min, and use 50mL ice-cold EPWB buffer (6mmol / L NaH 2 PO 4 (pH8.0), 1mmol / LMgCl 2 ) washed 3 times; with 50mL ice-cold EPB solution (6mmol / L NaH...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides construction and application of a shuttle vector between Escherichia coli and Lactobacilli. The invention relates to the technical field of gene engineering, and aims to construct a shuttle vector between Escherichia coli and Lactobacilli. The vector is named pZLT3, and comprises a nucleotide sequence disclosed as SEQ ID NO:3 in the sequence table. The vector utilizes the Lactobacillus plantarum subsp. plantarum Zhang-LL (the collection number is CGMCC No.6936) strain as the framework of the natural plasmid pZLT3, and comprises a nucleotide sequence disclosed as SEQ ID NO:1 in the sequence table. The shuttle vector suitable for Escherichia coli and Lactobacilli has the characteristic of stable inheritance in Escherichia coli and Lactobacilli. The lactobacillus natural plasmid pZLT3 comprises a coding gene and all regulatory genes expressed by lactobacillus bacteriocin protein, so the shuttle vector can be directly used for expressing lactobacillus bacteriocin protein in Lactobacilli.

Description

technical field [0001] The invention belongs to the field of microbial genetic engineering, and specifically relates to a method for preparing a shuttle carrier between Escherichia coli and Lactobacillus and expressing lactobacillus using the shuttle carrier. The shuttle carrier of the invention can be used for protein expression in Lactobacillus. Background technique [0002] In the process of processing, storage, transportation, etc., food is easily polluted by harmful microorganisms, resulting in spoilage or food poisoning. Adding preservatives to inhibit the growth of microorganisms is an important means to prevent food spoilage. Studies have shown that some chemical preservatives are carcinogenic, teratogenic and cause food poisoning, which have a greater impact on human health, and their application is increasingly restricted by many countries. Biological preservatives are a new type of natural preservatives discovered in recent years, which have the advantages of non-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20C12N15/66C12N15/74C07K14/335
CPCC07K14/335C12N15/74C12N1/205C12R2001/25
Inventor 谢远红张红星刘慧熊利霞金君华高秀芝
Owner BEIJING UNIV OF AGRI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com